Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197966 (click for geneview)
Transcript ID ENST00000355473(link to ensembl)
Localtion Chromosome:2:132418849:132421441:-1 band: 2q21.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--T--R--T--D--A--P--D--L--L--V--S--T--V--Y--Q--D--I--K--V--A--T--P--G--P--A--S--K--R--S--P--C--E--
ATGACCCGTACGGACGCTCCGGACCTGCTGGTGTCGACCGTGTACCAGGACATCAAGGTGGCGACCCCGGGACCCGCTTCCAAGCGCTCGCCATGTGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--S--V--A--R--P--A--E--P--A--P--F--N--K--R--H--C--P--S--F--D--F--L--E--A--L--D--R--P--T--T--E--T--L
GATCCGTGGCCCGGCCTGCTGAGCCCGCGCCTTTCAACAAGCGCCACTGCCCCAGCTTCGACTTCCTGGAGGCGCTGGACCGGCCGACCACGGAGACCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--E--P--P--P--P--E--P--A--V--P--R--A--R--T--R--E--A--E--P--R--R--R--A--R--S--K--S--A--P--P--G--L-
GCCGGAGCCACCGCCCCCGGAGCCCGCTGTGCCGCGCGCCCGGACCCGCGAGGCCGAGCCACGCCGCCGCGCCCGCTCCAAGAGCGCGCCCCCGGGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------><---
-T--P--A--P--A--L--P--P--V--L--P--R--R--G--R--E--A--Q--R--A--A--R--A--E--A--S--P--R--P--C--Q--L--L--
ACGCCCGCGCCCGCCTTGCCGCCCGTGTTGCCCCGCCGAGGGCGGGAGGCCCAGCGTGCGGCGCGGGCCGAGGCATCGCCGCGCCCTTGCCAACTACTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--P--I--K--L--Q--P--Q--L--G--G--P--G--H--I--A--P--L--C--A--A--A--G--R--R--A--P--P--E--P--P--A--G--P
GTCCCATCAAGTTGCAGCCGCAGCTGGGCGGCCCAGGCCACATCGCGCCCCTGTGCGCCGCCGCGGGCCGCCGCGCACCTCCCGAGCCACCCGCGGGTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------><---------------------------------------------------><---------------------------
--Y--P--Y--V--R--S--P--D--I--K--P--D--D--A--V--L--Q--H--A--A--W--G--S--R--T--P--T--P--S--D--S--Y--C-
CTATCCCTACGTGCGCTCCCCGGACATCAAGCCAGACGACGCAGTGCTCCAGCACGCCGCCTGGGGCTCACGCACCCCGACGCCAAGCGACTCATACTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--D--P--R--A--F--Y--C--D--G--P--L--P--G--P--R--D--Y--A--E--R--R--S--L--P--F--I--T--P--P--G--P--T--
GCGGATCCCCGGGCGTTCTACTGCGACGGGCCCCTGCCTGGGCCCCGGGACTACGCCGAGCGCCGCAGTCTGCCCTTCATCACCCCTCCGGGCCCCACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--F--F--Y--T--E--E--P--Q--G--F--R--G--S--F--A--A--S--P--G--P--T--F--D--A--Y--C--P--R--P--Y--P--S--E
AGTTCTTCTATACAGAGGAGCCCCAAGGCTTCCGGGGCAGCTTTGCGGCCAGTCCCGGTCCAACCTTCGACGCCTACTGCCCCAGGCCCTATCCGTCGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--L--P--G--P--S--P--R--C--M--G--G--Y--Y--A--G--E--V--G--T--F--P--I--Q--E--P--S--S--R--S--Y--Y--G-
GGAGCTCCCAGGGCCCAGTCCAAGGTGCATGGGGGGCTACTACGCGGGAGAGGTGGGCACCTTCCCAATCCAGGAACCGTCCTCCCGCTCCTACTATGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--A--P--R--A--Y--G--L--P--Y--G--P--G--Y--V--P--E--E--P--R--A--H--S--T--A--R--P--F--Y--T--E--D--F--
GAGGCTCCCCGAGCCTACGGCCTGCCCTATGGGCCCGGCTATGTCCCTGAGGAGCCCCGGGCCCACTCCACCGCCCGCCCTTTTTACACGGAGGACTTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--K--Y--R--E--R--D--V--L--A--R--T--Y--P--H--Q--R--S--S--P--A--W--A--D--W--G--L--R--P--Y--R--T--L--Q
GAAAATACCGTGAGCGTGACGTCCTGGCTCGGACGTACCCGCACCAGCGTAGCAGCCCAGCCTGGGCGGACTGGGGCCTGCGACCCTACCGCACCCTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--V--Q--S--S--D--P--D--P--L--L--A--S--W--H--G--G--T--G--T--S--P--P--R--L--A--T--D--S--R--H--Y--S-
AGTGGTGCAGTCCTCTGACCCCGACCCGTTGCTCGCCTCCTGGCATGGCGGCACCGGCACCAGTCCACCCCGGCTGGCTACCGACAGCCGCCACTACTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------><----------------------------------><---------------------------
-C--S--W--D--N--V--L--A--P--G--R--A--D--Q--L--G--R--G--R--S--Y--E--N--L--G--R--E--V--R--E--P--R--G--
TGCTCCTGGGACAACGTTCTGGCCCCGGGCCGTGCGGACCAGTTGGGCCGTGGCCGCAGCTATGAGAACCTGGGGCGCGAGGTGCGGGAGCCGCGAGGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--S--P--E--G--W--C--P--P--V--V--V--N--L--S--T--S--P--R--R--Y--A--P--L--S--L--S--D--T--S--L--T--E--K
TGTCCCCCGAAGGCTGGTGCCCGCCCGTCGTCGTGAACCTGTCCACCTCGCCCAGACGCTATGCCCCACTGTCCCTGTCTGACACGTCGCTGACGGAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------------><-----------
--G--R--A--G--E--G--P--G--R--N--W--Y--V--M--P--E--I--T--I--T--D--N--D--L--H--A--T--E--R--T--R--A--W-
GGGCCGCGCGGGTGAGGGCCCGGGCCGCAACTGGTACGTGATGCCCGAGATCACCATCACTGACAATGACCTGCACGCCACCGAGCGCACCAGGGCCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--L--P--G--G--C--T--R--P--L--P--H--A--A--P--D--G--P--T--S--G--R--Q--R--I--L--E--Q--L--Y--E--L--I--
GAGTTGCCCGGGGGCTGCACGCGGCCACTTCCCCATGCGGCCCCCGACGGCCCCACCTCTGGCCGCCAGCGGATCCTAGAGCAGCTGTACGAGCTCATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--D--L--V--I--D--L--R--P--T--A--S--Q--A--S--E--P--T--T--H--C--L--G--P--Q--L--C--Q--L--L--D--S--R--P
AGGACCTGGTCATCGACTTGCGACCCACTGCCAGCCAGGCCTCAGAGCCCACAACCCACTGCCTGGGCCCCCAACTGTGCCAACTGCTGGACTCGCGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--G--S--G--A--P--A--L--V--P--P--R--S--P--P--A--S--A--G--I--V--Q--E--P--A--A--P--G--E--V--A--D--M-
CGCGGGCTCCGGGGCCCCCGCGCTGGTGCCGCCACGCTCGCCCCCAGCCTCCGCCGGCATCGTCCAGGAGCCCGCGGCCCCGGGAGAGGTGGCCGACATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--P--E--P--S--A--D--E--D--D--L--M--T--C--S--S--A--R--C--W--H--T--E--T--M--F--N--A--C--L--Y--V--K--
TCCCCGGAACCCAGTGCCGACGAAGACGACCTGATGACCTGCTCCAGTGCGCGCTGCTGGCACACAGAGACCATGTTCAACGCCTGCCTCTACGTCAAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><-------------------------------------------------------
S--C--H--S--C--Y--T--Y--Y--C--S--R--L--C--P--E--D--W--D--V--H--K--A--R--C--V--Y--G--R--V--G--S--V--C
CCTGCCACAGCTGCTACACCTACTACTGCTCACGCCTGTGCCCGGAGGACTGGGACGTCCACAAGGCGCGCTGCGTGTACGGCCGCGTGGGCAGCGTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--Y--M--L--Q--F--C--L--D--S--V--P--V--H--R--A--F--S--P--M--A--G--V--G--F--L--S--R--R--R--S--V--L-
CCGCTACATGCTGCAGTTTTGCCTTGACAGTGTCCCAGTGCACCGCGCCTTCTCGCCCATGGCTGGTGTGGGTTTCCTGTCGCGCAGGCGCAGCGTGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-F--L--G--F--P--S--P--G--S--A--E--N--F--L--R--F--G--L--E--G--L--L--L--S--P--T--Q--L--S--L--R--E--L--
TTCCTGGGCTTCCCAAGTCCAGGCTCAGCCGAAAACTTCCTGCGCTTTGGCCTGGAGGGGCTGCTGCTATCCCCCACCCAACTATCGCTGCGTGAGCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------><----------------------------><----------------------------
A--T--H--A--A--P--L--G--S--Y--I--R--E--L--A--A--G--R--L--Y--E--P--A--E--F--L--L--S--V--S--V--A--V--G
CGACACACGCAGCGCCCCTGGGCAGCTACATACGCGAGCTGGCCGCTGGGCGCCTCTACGAGCCGGCAGAGTTCCTGCTCAGCGTGTCCGTGGCCGTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--S--T--A--P--L--G--T--S--A--L--P--A--P--T--P--P--S--H--G--P--T--V--R--K--L--A--K--V--A--L--A--A-
ACCCAGCACCGCGCCCCTGGGGACATCCGCCCTGCCCGCGCCCACGCCACCCAGCCATGGGCCAACAGTGCGCAAGTTAGCCAAGGTAGCGCTGGCGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------->
-G--S--P--W--W--P--P--L--V--R--S--S--D--P--D--M--K--T--L--I--L--T--P--P--P--G--T-
GGCAGCCCCTGGTGGCCGCCCCTGGTGCGGAGCAGCGACCCCGACATGAAGACGCTGATCCTGACGCCACCGCCGGGCACC
                                                                                 
---------------------------------------------------------------------------------
---------------------------------------------------------------------------------