Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197398 (click for geneview)
Transcript ID ENST00000355796(link to ensembl)
Symbol Q9H962_HUMAN
Localtion Chromosome:16:87827474:87829903:1 band: 16q24.3
Description Hypothetical protein FLJ44741.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Q--R--N--S--T--H--T--A--Y--A--T--Q--L--T--L--Y--A--T--Q--L--A--L--H--M--Q--F--N--S--H--C--V--C--
ATGCAACGCAACTCAACTCATACTGCATATGCAACTCAACTCACACTGTATGCAACTCAGCTCGCTCTGCATATGCAATTCAACTCGCACTGCGTATGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--S--T--Y--C--I--C--N--S--T--H--C--V--C--N--S--T--R--T--A--Y--A--T--Q--L--A--L--R--M--Q--L--N--S--H
AATCAACTTACTGCATATGCAACTCAACTCACTGCGTATGCAACTCAACTCGCACTGCATATGCAACTCAACTCGCACTGCGTATGCAACTCAACTCGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--V--C--N--S--A--R--T--A--Y--A--T--Q--L--L--Q--V--L--I--S--G--H--F--L--F--L--T--T--T--P--S--Q--Y-
CTGCGTATGCAACTCAGCTCGCACTGCGTATGCAACTCAACTGTTGCAAGTACTTATTTCCGGCCACTTCCTTTTTCTAACTACCACACCAAGCCAGTAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-F--S--S--L--K--S--A--Q--D--E--A--L--D--S--R--T--C--C--M--P--L--G--L--L--E--V--C--R--L--A--S--P--R--
TTCTCCTCCCTGAAGTCAGCCCAGGATGAGGCACTAGACAGCAGGACATGCTGTATGCCCTTGGGCCTGCTGGAAGTATGCAGACTAGCCAGCCCCAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--H--P--A--L--S--C--L--S--C--E--N--P--V--A--S--A--S--P--G--S--D--F--C--L--L--P--S--S--A--A--P--L--G
TTCATCCTGCCCTGTCCTGCCTTTCCTGTGAAAACCCTGTGGCCTCTGCCTCCCCTGGCTCTGACTTCTGCCTCCTGCCCAGCTCTGCAGCTCCCCTTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------->
--P--C--L--E--*-
GCCCTGCCTGGAGTGA
                
----------------
----------------