Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197734 (click for geneview)
Transcript ID ENST00000355883(link to ensembl)
Symbol NP_777603.1
Localtion Chromosome:14:77296646:77305838:1 band: 14q24.3
Description hypothetical protein FLJ25976
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<------------------------------------------------------------------------><------------><-----------
-M--G--R--E--M--K--K--T--G--T--P--R--P--F--R--I--E--D--P--N--Q--Q--P--T--W--H--D--Q--P--E--M--G--S--
ATGGGAAGAGAAATGAAGAAGACTGGTACTCCCAGACCCTTCCGTATCGAGGACCCCAATCAACAACCCACCTGGCATGATCAACCAGAGATGGGGTCCC
      ::::::::.::.: :.  ::::::::::::::::::::::::::::::::::::::::::::::::                            
------AGAGAAATAAAAACGGAGGGTACTCCCAGACCCTTCCGTATCGAGGACCCCAATCAACAACCCACC----------------------------
-------R--E--I--K--T--E--G--T--P--R--P--F--R--I--E--D--P--N--Q--Q--P--T-----------------------------

----------------------------------------------------------------------------------------------------
H--Y--F--A--Q--A--G--L--E--L--L--G--S--S--N--P--P--A--S--A--S--Q--S--A--G--I--T--G--V--S--H--C--A--R
ACTATTTTGCCCAGGCTGGTCTTGAACTGCTGGGCTCAAGCAATCCTCCTGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTGTGCCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--G--E--H--D--L--N--H--T--V--F--Q--V--K--D--S--T--F--L--R--H--L--E--S--D--R--P--E--F--K--S--C--L-
GCCCGGAGAACATGATCTTAACCATACTGTCTTCCAAGTGAAAGATTCTACCTTTCTAAGACATCTGGAGTCAGACAGACCTGAGTTCAAGTCGTGCCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------->
-P--P--H--F--T--E--P--S--V--S--L--S--T--S--E--G--C--E--D--A--M--G--*-
CCTCCCCACTTTACTGAACCTTCAGTGAGTCTTTCTACCTCAGAAGGCTGTGAGGATGCCATGGGGTAA
                                                                     
---------------------------------------------------------------------
---------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000879036
------AGAGAAATAAAAACGGAGGGTACTCCCAGACCCTTCCGTATCGAGGACCCCAATCAACAACCCACC----------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------------


>BGISUSP0000879036
--REIKTEGTPRPFRIEDPNQQPT----------------------------------------------------------------------------
-----------------------