Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196892 (click for geneview)
Transcript ID ENST00000356086(link to ensembl)
Symbol NM_017622.1
Localtion Chromosome:17:8032391:8034186:1 band: 17p13.1
Description hypothetical protein FLJ20014 (FLJ20014), mRNA
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Q--P--T--L--S--A--V--S--S--C--T--A--P--P--R--P--R--S--R--R--S--T--R--P--P--S--S--R--L--N--R--S--
ATGCAACCCACGCTCAGCGCCGTCAGCTCCTGCACCGCGCCACCCAGACCGCGAAGCAGACGGTCCACCCGGCCTCCCAGCTCCCGACTCAACCGCTCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--S--R--S--T--S--G--S--I--G--G--M--A--G--V--G--V--G--A--G--A--G--Q--G--R--A--G--A--E--G--G--G--G--G
GATCCCGCAGCACCTCGGGGTCGATTGGGGGAATGGCCGGTGTGGGTGTGGGTGCAGGCGCTGGGCAGGGCCGCGCAGGGGCAGAAGGCGGGGGTGGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--P--L--R--R--I--L--S--C--R--L--L--A--T--K--W--V--R--S--P--W--R--L--T--V--P--S--S--S--R--G--L--E-
CGCGCCGCTCAGACGGATCTTGAGTTGCAGGTTGTTGGCGACAAAGTGGGTAAGGTCGCCGTGGCGGCTCACTGTGCCTTCGAGCTCCAGGGGACTGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-M--V--A--R--R--P--P--P--A--P--D--S--A--L--P--E--D--P--A--P--P--H--A--S--L--S--P--S--R--L--R--L--S--
ATGGTGGCGCGGCGTCCGCCGCCCGCGCCGGACTCGGCACTCCCTGAGGACCCGGCGCCACCGCACGCCTCGCTCAGCCCGTCCAGGCTGCGGCTGTCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

->
*-
GA
  
--
--