Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000143940 (click for geneview)
Transcript ID ENST00000356458(link to ensembl)
Symbol Q6ZMW3_HUMAN
Localtion Chromosome:2:55029876:55110105:1 band: 2p16.1
Description Hypothetical protein FLJ16635.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------><---------------------------------------------------------------------------------
-M--Y--A--L--D--K--G--F--V--T--G--G--K--D--G--I--V--E--L--W--D--D--M--F--E--R--C--L--K--T--Y--A--I--
ATGTATGCACTGGATAAGGGCTTTGTAACAGGTGGAAAGGACGGCATCGTGGAGCTCTGGGATGATATGTTTGAAAGATGTTTGAAGACTTATGCCATTA
                  ::.::::::::::::::::::::.:: ::.::::::::::::::::::::::::::::::::.:::::::::::::::::::
------------------GGTTTTGTAACAGGTGGAAAGGATGGAATTGTGGAGCTCTGGGATGATATGTTTGAAAGATGCTTGAAGACTTATGCCATTA
-------------------G--F--V--T--G--G--K--D--G--I--V--E--L--W--D--D--M--F--E--R--C--L--K--T--Y--A--I--

-----------------------------><---------------------------------------------------------------------
K--R--S--A--L--S--T--S--S--K--G--L--L--L--E--D--N--P--S--I--R--A--I--T--L--G--H--G--H--I--L--V--G--T
AAAGATCAGCATTGTCGACTAGCTCAAAAGGCTTGCTTTTGGAAGATAACCCTTCAATTCGTGCCATCACTTTGGGACATGGACATATCCTGGTGGGAAC
::::: ::::::::::.:::::.::::::   :::::::::::::::::::::::::::::::::::::::::.::::::::::::::::: ::::::::
AAAGAGCAGCATTGTCAACTAGTTCAAAA---TTGCTTTTGGAAGATAACCCTTCAATTCGTGCCATCACTTTAGGACATGGACATATCCTCGTGGGAAC
K--R--A--A--L--S--T--S--S--K-----L--L--L--E--D--N--P--S--I--R--A--I--T--L--G--H--G--H--I--L--V--G--T

---------------------------------------------------------><-----------------------------------------
--K--N--G--E--I--L--E--I--D--K--S--G--P--M--T--L--L--V--Q--G--H--M--E--G--E--V--W--G--L--A--A--H--P-
AAAAAATGGAGAGATTCTGGAAATTGATAAGAGTGGCCCAATGACACTGCTTGTTCAGGGGCACATGGAAGGAGAAGTGTGGGGGTTGGCAGCTCACCCT
:::::::::::::::.::::::::.:::::.::::: :::::::::::::::::::::                                          
AAAAAATGGAGAGATCCTGGAAATCGATAAAAGTGGACCAATGACACTGCTTGTTCAG------------------------------------------
--K--N--G--E--I--L--E--I--D--K--S--G--P--M--T--L--L--V--Q-------------------------------------------

--------------------------------------------------------------------------------------------------->
-L--L--P--I--C--A--T--V--S--D--D--K--T--L--R--I--W--E--L--S--A--Q--H--R--M--L--A--V--R--K--L--K--K--
CTCCTGCCCATCTGTGCAACAGTGAGCGATGATAAAACACTTCGCATCTGGGAACTATCTGCCCAGCACCGTATGCTGGCAGTACGGAAACTCAAAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

<---------------------------------------------------------------------------------------------------
G--G--R--C--C--A--F--S--P--D--G--K--A--L--A--V--G--L--N--D--G--S--F--L--V--V--N--A--D--T--V--E--D--M
GTGGAAGATGCTGTGCCTTTTCCCCTGATGGGAAAGCCTTAGCGGTTGGCTTGAACGATGGGAGTTTCCTGGTGGTAAATGCTGACACTGTTGAAGACAT
  :::::::::::::::::.:::::::::::::::::::::::.::.::::::::.::::::::::::::::: ::::::::::::::::::::::::::
--GGAAGATGCTGTGCCTTCTCCCCTGATGGGAAAGCCTTAGCAGTCGGCTTGAATGATGGGAGTTTCCTGGTTGTAAATGCTGACACTGTTGAAGACAT
---G--R--C--C--A--F--S--P--D--G--K--A--L--A--V--G--L--N--D--G--S--F--L--V--V--N--A--D--T--V--E--D--M

----------------------------------------------------><----------------------------------------------
--V--S--F--H--H--R--K--E--M--I--S--D--I--K--F--S--K--D--T--G--K--Y--L--A--V--A--S--H--D--N--F--V--D-
GGTCTCTTTCCATCACAGAAAAGAAATGATCTCTGATATTAAGTTTTCAAAAGATACGGGAAAATACCTTGCCGTGGCATCCCATGATAACTTTGTGGAT
::::::.:::::::::::::::::::::::::::::.:::::::::::::::   ::.::::::::::::::::::::::: ::::::::::::::::::
GGTCTCCTTCCATCACAGAAAAGAAATGATCTCTGACATTAAGTTTTCAAAA---ACAGGAAAATACCTTGCCGTGGCATCACATGATAACTTTGTGGAT
--V--S--F--H--H--R--K--E--M--I--S--D--I--K--F--S--K-----T--G--K--Y--L--A--V--A--S--H--D--N--F--V--D-

------------------------------------------------------------------------------------><--------------
-I--Y--N--V--L--T--S--K--R--V--G--I--C--K--G--A--S--S--Y--I--T--H--I--D--W--D--S--R--G--K--L--L--Q--
ATTTACAACGTACTTACAAGCAAAAGGGTTGGCATCTGTAAAGGTGCTTCTAGTTATATTACACACATTGACTGGGACTCTAGAGGAAAATTATTGCAAG
::::::::.::::: ::::::::.::::::::::::::::::::::::::::::::.:::::::::::::::::::::::::::                
ATTTACAATGTACTGACAAGCAAGAGGGTTGGCATCTGTAAAGGTGCTTCTAGTTACATTACACACATTGACTGGGACTCTAGA----------------
-I--Y--N--V--L--T--S--K--R--V--G--I--C--K--G--A--S--S--Y--I--T--H--I--D--W--D--S--R-----------------

-------------------------------------------------------------------------><-------------------------
V--N--S--G--A--R--E--Q--L--F--F--E--A--P--R--G--K--R--H--I--I--R--P--S--E--I--E--K--I--E--W--D--T--W
TGAATTCAGGTGCCAGAGAACAACTTTTTTTTGAAGCTCCAAGAGGCAAACGGCATATAATAAGACCTTCAGAGATCGAGAAGATAGAGTGGGACACATG
                                                                             :::::::::::::::::::::::
-----------------------------------------------------------------------------GAGAAGATAGAGTGGGACACATG
------------------------------------------------------------------------------E--K--I--E--W--D--T--W

----------------------------------------------------------------------------------------------------
--T--C--V--L--G--P--T--C--E--G--I--W--P--A--H--S--D--I--T--D--V--N--A--A--S--L--T--K--D--C--S--L--L-
GACCTGTGTCCTGGGGCCCACCTGTGAGGGAATCTGGCCAGCACATAGCGATATAACTGACGTAAATGCTGCCAGTCTTACCAAAGACTGTTCCCTTTTA
:::::::::.::::: :::::::::::::::::::::::::.:::.::.:::.:.:::::.:::::::::::::::::.:::::::::::::::::.:::
GACCTGTGTTCTGGGCCCCACCTGTGAGGGAATCTGGCCAGTACACAGTGATGTGACTGATGTAAATGCTGCCAGTCTCACCAAAGACTGTTCCCTCTTA
--T--C--V--L--G--P--T--C--E--G--I--W--P--V--H--S--D--V--T--D--V--N--A--A--S--L--T--K--D--C--S--L--L-

--------------------------------------------------><------------------------------------------------
-A--T--G--D--D--F--G--F--V--K--L--F--S--Y--P--V--K--G--Q--H--A--R--F--K--K--Y--V--G--H--S--A--H--V--
GCCACCGGAGATGATTTTGGTTTCGTTAAGCTTTTTTCATATCCTGTCAAGGGACAGCACGCAAGATTCAAGAAGTATGTGGGGCACAGTGCACATGTCA
::::: :::::::::::::::::::::::::::::::::::::::::::::                                                 
GCCACAGGAGATGATTTTGGTTTCGTTAAGCTTTTTTCATATCCTGTCAAG-------------------------------------------------
-A--T--G--D--D--F--G--F--V--K--L--F--S--Y--P--V--K--------------------------------------------------

----------------------------------------------------------------------------------------------------
T--N--V--R--W--L--H--N--D--S--V--L--L--T--V--G--G--A--D--T--A--L--M--I--W--T--R--E--F--V--G--T--Q--E
CTAACGTGAGGTGGCTGCACAATGACTCTGTGCTGCTCACGGTGGGCGGCGCCGACACAGCCCTGATGATCTGGACCAGGGAGTTTGTGGGGACCCAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
--S--K--L--V--D--S--E--E--S--D--T--D--V--E--E--D--G--G--Y--D--S--D--V--A--R--E--K--A--I--D--Y--T--T-
GAGCAAGCTGGTGGACAGCGAGGAGTCAGACACCGACGTGGAAGAGGATGGAGGCTATGACAGCGATGTTGCTAGAGAAAAGGCCATTGACTACACCACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------><-------------------
-K--I--Y--A--V--S--I--R--E--M--E--G--T--K--P--H--Q--Q--L--K--E--V--S--V--E--E--R--P--P--V--S--R--A--
AAGATTTATGCTGTGAGCATCAGGGAAATGGAAGGCACCAAGCCACACCAGCAGCTGAAGGAAGTTTCCGTGGAAGAAAGACCACCCGTTAGCCGAGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
A--P--Q--P--E--K--L--Q--K--N--N--I--T--K--K--K--K--L--V--E--E--L--A--L--D--H--V--F--G--Y--R--G--F--D
CTCCCCAGCCTGAGAAACTGCAGAAGAACAATATCACCAAAAAAAAGAAACTGGTTGAGGAGCTGGCTCTAGACCACGTGTTTGGCTACAGAGGTTTCGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------><----------
--C--R--N--N--L--H--Y--L--N--D--G--A--D--I--I--F--H--T--A--A--A--G--I--V--Q--N--L--S--T--G--S--Q--S-
CTGTCGAAATAACCTGCATTACCTTAATGATGGCGCTGACATCATCTTCCACACAGCAGCGGCTGGCATCGTTCAGAACCTCTCCACAGGGAGCCAGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------------><-----------
-F--Y--L--E--H--T--D--D--I--L--C--L--T--V--N--Q--H--P--K--Y--R--N--V--V--A--T--S--Q--I--G--D--I--T--
TTCTATCTGGAGCACACAGATGACATCCTCTGTCTCACAGTGAACCAGCACCCCAAGTACAGAAACGTGGTGGCCACCAGCCAGATAGGTGATATTACGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------><------------------------------------------------------------------------------------------
E--T--P--G--T--T--P--S--I--H--I--W--D--A--M--T--K--H--T--L--S--M--L--R--C--F--H--S--K--G--V--N--Y--I
AAACCCCAGGGACAACACCTTCCATCCACATATGGGACGCCATGACCAAACACACCCTCTCCATGCTGCGGTGCTTCCACTCCAAGGGGGTGAATTACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------><----------------
--N--F--S--A--T--G--K--L--L--V--S--V--G--V--D--P--E--H--T--I--T--V--W--R--W--Q--E--G--A--K--V--A--S-
CAACTTCAGTGCAACTGGAAAGCTCCTGGTGTCGGTGGGAGTGGACCCTGAGCACACCATCACTGTCTGGCGATGGCAGGAAGGTGCCAAGGTTGCCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--G--G--H--L--E--R--I--F--V--V--E--F--R--P--D--S--D--T--Q--F--V--S--V--G--V--K--H--M--K--F--W--T--
CGAGGGGGTCACCTGGAGCGCATATTTGTGGTGGAATTTCGCCCCGACTCAGACACGCAGTTTGTATCTGTCGGGGTCAAACATATGAAGTTCTGGACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------------><-------
L--A--G--S--A--L--L--Y--K--K--G--V--I--G--S--L--G--A--A--K--M--Q--T--M--L--S--V--A--F--G--A--N--N--L
TGGCAGGCAGCGCCTTGCTTTACAAGAAAGGGGTCATCGGGTCCCTGGGAGCTGCCAAAATGCAGACGATGCTCTCCGTGGCCTTCGGTGCTAACAATCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--F--T--G--A--I--N--G--D--V--Y--V--W--K--D--H--F--L--I--R--L--V--A--K--A--H--T--G--P--V--F--T--M-
CACTTTCACGGGTGCCATCAATGGAGATGTCTACGTCTGGAAGGACCACTTCCTCATCCGGCTGGTGGCCAAGGCTCACACAGGCCCCGTGTTCACAATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------><-------------------------------------------------
-Y--T--T--L--R--D--G--L--I--V--T--G--G--K--E--R--P--T--K--E--G--G--A--V--K--L--W--D--Q--E--M--K--R--
TACACAACCCTTCGGGATGGACTCATAGTGACCGGCGGAAAAGAGAGGCCGACCAAAGAAGGAGGTGCTGTAAAATTGTGGGACCAGGAGATGAAGCGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
C--R--A--F--Q--L--E--T--G--Q--L--V--E--C--V--R--S--V--C--R--G--K--G--K--I--L--V--G--T--K--D--G--E--I
GCCGGGCCTTTCAGCTGGAGACCGGGCAGCTGGTGGAGTGTGTGCGCTCCGTGTGCCGTGGAAAAGGAAAAATCTTAGTGGGAACCAAAGACGGAGAAAT
                                                                 ::::::::.::::::::::::::.::.::::::::
-----------------------------------------------------------------GGAAAAATTTTAGTGGGAACCAAGGATGGAGAAAT
------------------------------------------------------------------G--K--I--L--V--G--T--K--D--G--E--I

----------------------------------------------------------------------------------------------------
--I--E--V--G--E--K--N--A--A--S--N--I--L--I--D--G--H--M--E--G--E--I--W--G--L--A--T--H--P--S--K--D--L-
AATTGAAGTTGGTGAAAAAAATGCTGCTTCTAACATCCTGATTGATGGTCACATGGAAGGGGAGATCTGGGGCCTGGCCACTCACCCTTCCAAGGACCTC
::: ::::: :::: : :::::::::::::.::::::::::::::::: :::::::::::::::::::::::::::::::: :::::.::::::::: ::
AATAGAAGTGGGTGTATAAAATGCTGCTTCCAACATCCTGATTGATGGACACATGGAAGGGGAGATCTGGGGCCTGGCCACACACCCCTCCAAGGACATC
--I--E--V--G--V--*--N--A--A--S--N--I--L--I--D--G--H--M--E--G--E--I--W--G--L--A--T--H--P--S--K--D--I-

-----------------------------------------------------><---------------------------------------------
-F--I--S--A--S--N--D--G--T--A--R--I--W--D--L--A--D--K--K--L--L--N--K--V--S--L--G--H--A--A--R--C--A--
TTCATCTCTGCCAGCAACGATGGCACAGCCCGGATCTGGGACCTGGCTGACAAGAAGCTGTTAAACAAGGTGAGCTTGGGCCATGCGGCCAGGTGTGCAG
::::::::::::::::::::.::::::::::: ::::::::::::::.::.::::::::..: ::::::::::.:.::::::::::.:::::::::::::
TTCATCTCTGCCAGCAACGACGGCACAGCCCGCATCTGGGACCTGGCCGATAAGAAGCTACTCAACAAGGTGAACCTGGGCCATGCAGCCAGGTGTGCAG
-F--I--S--A--S--N--D--G--T--A--R--I--W--D--L--A--D--K--K--L--L--N--K--V--N--L--G--H--A--A--R--C--A--

----------------------------------------------------------------------------------------------------
A--Y--S--P--D--G--E--M--V--A--I--G--M--K--N--G--E--F--V--I--L--L--V--N--S--L--K--V--W--G--K--K--R--D
CCTACAGCCCTGATGGGGAGATGGTGGCCATTGGCATGAAGAATGGAGAGTTTGTCATCTTGTTGGTGAACAGCCTGAAAGTTTGGGGGAAAAAACGAGA
:::::::::::::.:::::::::::.:::::::::::::::::.:::::::::::::::::::::::::::::::::::::::::::::::.::::::::
CCTACAGCCCTGACGGGGAGATGGTAGCCATTGGCATGAAGAACGGAGAGTTTGTCATCTTGTTGGTGAACAGCCTGAAAGTTTGGGGGAAGAAACGAGA
A--Y--S--P--D--G--E--M--V--A--I--G--M--K--N--G--E--F--V--I--L--L--V--N--S--L--K--V--W--G--K--K--R--D

--------------------------><------------------------------------------------------------------------
--R--K--S--A--I--Q--D--I--R--I--S--P--D--N--R--F--L--A--V--G--S--S--E--H--T--V--D--F--Y--D--L--T--Q-
CCGGAAATCTGCTATCCAAGATATCAGAATCAGCCCAGACAACCGATTCTTAGCCGTTGGTTCTTCTGAACACACAGTTGACTTCTATGACCTCACTCAG
::::::::::::.::::::::::::                                                                           
CCGGAAATCTGCCATCCAAGATATC---------------------------------------------------------------------------
--R--K--S--A--I--Q--D--I----------------------------------------------------------------------------

-----------------------------------------------------------------------------------------><---------
-G--T--N--L--N--R--I--G--Y--C--K--D--I--P--S--F--V--I--Q--M--D--F--S--A--D--G--K--Y--I--Q--M--Q--L--
GGCACAAATCTGAACCGCATTGGCTACTGCAAAGATATCCCAAGCTTTGTCATTCAGATGGATTTTTCTGCGGATGGCAAATACATTCAGATGCAGCTGA
                                             ::::::::::::::::::::::::::.:::::::..:::::.:::          
---------------------------------------------TTTGTCATTCAGATGGATTTTTCTGCAGATGGCAGGTACATCCAG----------
----------------------------------------------F--V--I--Q--M--D--F--S--A--D--G--R--Y--I--Q-----------

----------------------------------------------------------------------------------------------------
T--L--L--V--G--N--H--T--Q--R--T--A--I--L--G--L--W--K--I--A--R--K--W--M--R--R--K--M--G--K--W--P--A--V
CGTTGCTGGTCGGGAACCACACTCAGAGAACCGCTATCTTAGGACTCTGGAAAATAGCGAGAAAATGGATGAGAAGAAAGATGGGAAAATGGCCTGCTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------->
--V--V--M--G--W--P--*-
TGTTGTCATGGGCTGGCCATAG
                      
----------------------
----------------------

Pig Consensus Sequence

>BGISUST0000878335
------------------GGTTTTGTAACAGGTGGAAAGGATGGAATTGTGGAGCTCTGGGATGATATGTTTGAAAGATGCTTGAAGACTTATGCCATTA
AAAGAGCAGCATTGTCAACTAGTTCAAAA---TTGCTTTTGGAAGATAACCCTTCAATTCGTGCCATCACTTTAGGACATGGACATATCCTCGTGGGAAC
AAAAAATGGAGAGATCCTGGAAATCGATAAAAGTGGACCAATGACACTGCTTGTTCAG------------------------------------------
----------------------------------------------------------------------------------------------------
--GGAAGATGCTGTGCCTTCTCCCCTGATGGGAAAGCCTTAGCAGTCGGCTTGAATGATGGGAGTTTCCTGGTTGTAAATGCTGACACTGTTGAAGACAT
GGTCTCCTTCCATCACAGAAAAGAAATGATCTCTGACATTAAGTTTTCAAAA---ACAGGAAAATACCTTGCCGTGGCATCACATGATAACTTTGTGGAT
ATTTACAATGTACTGACAAGCAAGAGGGTTGGCATCTGTAAAGGTGCTTCTAGTTACATTACACACATTGACTGGGACTCTAGA----------------
-----------------------------------------------------------------------------GAGAAGATAGAGTGGGACACATG
GACCTGTGTTCTGGGCCCCACCTGTGAGGGAATCTGGCCAGTACACAGTGATGTGACTGATGTAAATGCTGCCAGTCTCACCAAAGACTGTTCCCTCTTA
GCCACAGGAGATGATTTTGGTTTCGTTAAGCTTTTTTCATATCCTGTCAAG-------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------GGAAAAATTTTAGTGGGAACCAAGGATGGAGAAAT
AATAGAAGTGGGTGTATAAAATGCTGCTTCCAACATCCTGATTGATGGACACATGGAAGGGGAGATCTGGGGCCTGGCCACACACCCCTCCAAGGACATC
TTCATCTCTGCCAGCAACGACGGCACAGCCCGCATCTGGGACCTGGCCGATAAGAAGCTACTCAACAAGGTGAACCTGGGCCATGCAGCCAGGTGTGCAG
CCTACAGCCCTGACGGGGAGATGGTAGCCATTGGCATGAAGAACGGAGAGTTTGTCATCTTGTTGGTGAACAGCCTGAAAGTTTGGGGGAAGAAACGAGA
CCGGAAATCTGCCATCCAAGATATC---------------------------------------------------------------------------
---------------------------------------------TTTGTCATTCAGATGGATTTTTCTGCAGATGGCAGGTACATCCAG----------
----------------------------------------------------------------------------------------------------
----------------------


>BGISUSP0000878335
------GFVTGGKDGIVELWDDMFERCLKTYAIKRAALSTSSK-LLLEDNPSIRAITLGHGHILVGTKNGEILEIDKSGPMTLLVQ--------------
----------------------------------GRCCAFSPDGKALAVGLNDGSFLVVNADTVEDMVSFHHRKEMISDIKFSK-TGKYLAVASHDNFVD
IYNVLTSKRVGICKGASSYITHIDWDSR-------------------------------EKIEWDTWTCVLGPTCEGIWPVHSDVTDVNAASLTKDCSLL
ATGDDFGFVKLFSYPVK-----------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------GKILVGTKDGEIIEVGV*NAASNILIDGHMEGEIWGLATHPSKDI
FISASNDGTARIWDLADKKLLNKVNLGHAARCAAYSPDGEMVAIGMKNGEFVILLVNSLKVWGKKRDRKSAIQDI-------------------------
---------------FVIQMDFSADGRYIQ--------------------------------------------