Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197083 (click for geneview)
Transcript ID ENST00000356555(link to ensembl)
Symbol XP_293828.4
Localtion Chromosome:5:178383412:178394655:1 band: 5q35.3
Description PREDICTED: similar to hypothetical protein 9630041N07
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------><------------------------------------------------------------------
-M--A--R--R--L--L--P--A--H--V--Q--E--S--V--T--F--R--D--V--A--V--F--F--S--Q--D--E--W--L--H--L--D--S--
ATGGCAAGGAGGTTGCTGCCAGCCCATGTACAGGAGTCCGTGACGTTCAGGGATGTGGCCGTGTTCTTCAGCCAGGACGAGTGGTTGCACCTGGACTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------><---------------------------------------
A--Q--R--A--L--Y--R--E--V--M--L--E--N--Y--S--I--L--V--S--L--G--I--L--F--S--K--P--K--V--I--S--Q--L--E
CCCAGAGAGCCTTGTACCGGGAGGTGATGCTGGAGAACTACAGCATCCTGGTCTCACTGGGGATTCTCTTTTCCAAGCCAAAGGTCATCTCCCAGTTAGA
                                                              ::::: ::::::::.::::::::.::::.:::.:::::
--------------------------------------------------------------ATTCTGTTTTCCAAACCAAAGGTTATCTTCCAATTAGA
---------------------------------------------------------------I--L--F--S--K--P--K--V--I--F--Q--L--E

-------------------------------------------------------><-------------------------------------------
--Q--G--E--D--P--W--M--V--E--S--G--V--P--Q--G--A--H--L--G--W--E--S--L--F--G--T--I--V--S--K--E--E--N-
GCAAGGAGAAGACCCCTGGATGGTGGAGAGTGGAGTTCCCCAAGGCGCACATCTCGGATGGGAAAGCTTGTTTGGAACCATAGTTTCTAAAGAAGAAAAT
::::::.::::::::::::::::::::.:.::.::::.:.:::                                                         
GCAAGGGGAAGACCCCTGGATGGTGGAAAATGAAGTTTCTCAA---------------------------------------------------------
--Q--G--E--D--P--W--M--V--E--N--E--V--S--Q----------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--E--V--M--K--K--L--I--I--D--G--T--F--D--F--K--L--E--K--T--Y--I--N--E--D--K--L--E--K--Q--Q--G--K--
CAGGAAGTCATGAAAAAACTCATAATTGATGGCACATTTGACTTCAAGTTGGAGAAGACCTACATAAATGAAGATAAGTTAGAGAAGCAACAAGGCAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--N--R--L--F--S--K--V--L--V--T--I--K--K--V--Y--M--K--E--R--S--F--K--G--V--E--F--G--K--N--L--G--L--K
AGAACAGACTTTTCAGTAAAGTGTTAGTTACCATCAAAAAAGTCTACATGAAGGAGAGGAGCTTTAAAGGTGTTGAATTTGGGAAAAATCTTGGTCTAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--S--L--I--R--K--P--R--I--V--S--R--G--R--R--P--R--S--Q--Q--Y--S--V--L--F--K--Q--L--G--V--N--T--V-
ATCATCGCTTATTAGAAAACCGAGAATAGTTTCCAGAGGAAGGAGACCCCGTTCACAGCAGTATTCAGTTCTCTTTAAACAACTGGGGGTCAACACAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--K--C--Y--K--C--N--I--C--G--K--I--F--L--H--S--S--S--L--S--K--H--Q--R--I--H--T--G--E--K--L--Y--K--
CGTAAATGTTATAAATGTAATATCTGTGGGAAAATCTTCCTCCACAGTTCCTCCCTGAGTAAACACCAGAGAATCCACACTGGAGAGAAGCTCTATAAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
C--K--E--C--R--K--A--F--S--Q--S--S--S--L--T--Q--H--L--R--V--H--T--G--E--K--P--Y--I--C--S--E--C--G--K
GTAAGGAATGTAGGAAAGCCTTCAGCCAAAGCTCATCCCTAACTCAGCACTTGAGGGTTCATACAGGAGAGAAACCTTATATATGTAGTGAATGTGGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--F--S--F--T--T--S--L--I--G--H--Q--R--M--H--T--G--E--R--P--Y--K--C--K--E--C--G--K--T--F--K--G--S-
AGCCTTCAGTTTCACCACATCTCTTATTGGACACCAGAGAATGCATACTGGAGAGAGACCTTATAAATGCAAGGAATGTGGAAAAACATTTAAAGGTAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--S--L--N--N--H--Q--R--I--H--T--G--E--K--P--Y--K--C--N--E--C--G--R--A--F--S--Q--C--S--S--L--I--Q--
TCATCTCTTAATAATCACCAGCGAATTCACACAGGAGAGAAGCCCTATAAGTGTAATGAATGTGGGAGGGCCTTCAGTCAGTGCTCATCTCTCATTCAGC
                              :: ::::: :::::::::::::::::::::::::::::.:::::.::.::::::::::::::.:::::::
------------------------------ACTGGAGATAAGCCCTATAAGTGTAATGAATGTGGGAGAGCCTTTAGCCAGTGCTCATCTCTTATTCAGC
-------------------------------T--G--D--K--P--Y--K--C--N--E--C--G--R--A--F--S--Q--C--S--S--L--I--Q--

----------------------------------------------------------------------------------------------------
H--H--R--I--H--T--G--E--K--P--Y--E--C--T--Q--C--G--K--A--F--T--S--I--S--R--L--S--R--H--H--R--I--H--T
ACCACAGAATTCATACTGGGGAGAAACCGTATGAATGTACTCAGTGTGGGAAAGCCTTCACTTCAATATCGCGGCTAAGTAGGCACCATCGAATTCATAC
:.::.::::::::::::::.::::::::.:::::::::: ::::::::::::::::: .:::::::::::.:::::::::::.:::::: ::::::::::
ATCATAGAATTCATACTGGAGAGAAACCATATGAATGTAGTCAGTGTGGGAAAGCCTGTACTTCAATATCACGGCTAAGTAGACACCATAGAATTCATAC
H--H--R--I--H--T--G--E--K--P--Y--E--C--S--Q--C--G--K--A--C--T--S--I--S--R--L--S--R--H--H--R--I--H--T

----------------------------------------------------------------------------------------------------
--G--E--K--P--F--H--C--N--E--C--G--K--V--F--S--Y--H--S--A--L--I--I--H--Q--R--I--H--T--G--E--K--P--Y-
TGGAGAGAAACCCTTTCATTGTAACGAGTGTGGAAAAGTATTCAGCTATCACTCAGCCCTTATCATACATCAGAGAATTCACACTGGTGAGAAACCATAT
:::::::::::::::: :.:::::.::::::::::::::::::::.::.::::::::::::::.:::::::::::::::::.:::::::::::::: :::
TGGAGAGAAACCCTTTAACTGTAATGAGTGTGGAAAAGTATTCAGTTACCACTCAGCCCTTATTATACATCAGAGAATTCATACTGGTGAGAAACCCTAT
--G--E--K--P--F--N--C--N--E--C--G--K--V--F--S--Y--H--S--A--L--I--I--H--Q--R--I--H--T--G--E--K--P--Y-

----------------------------------------------------------------------------------------------------
-A--C--K--E--C--G--K--A--F--S--Q--S--S--A--L--I--Q--H--Q--R--I--H--T--G--E--K--P--Y--K--C--N--E--C--
GCATGCAAAGAATGTGGGAAAGCCTTCAGCCAAAGCTCAGCTCTCATACAACATCAAAGAATTCACACTGGAGAAAAACCCTACAAATGTAATGAATGTG
::.::.:::::::::::.:::::.::::::::::::::::::::.::::::::::::::::::::::::::::: ::::: :::::::::::::::::::
GCGTGTAAAGAATGTGGAAAAGCTTTCAGCCAAAGCTCAGCTCTTATACAACATCAAAGAATTCACACTGGAGA-AAACCGTACAAATGTAATGAATGTG
-A--C--K--E--C--G--K--A--F--S--Q--S--S--A--L--I--Q--H--Q--R--I--H--T--G--E--K--P--Y--K--C--N--E--C--

----------------------------------------------------------------------------------------------------
G--K--A--F--S--W--I--S--R--L--N--I--H--H--R--I--H--T--G--E--K--P--Y--N--C--K--E--C--G--K--A--F--S--S
GGAAAGCCTTCTCTTGGATTTCACGGCTTAATATACATCACAGAATTCACACTGGAGAGAAACCATATAATTGTAAGGAATGTGGAAAAGCCTTCAGTTC
::                                                                                                  
GG--------------------------------------------------------------------------------------------------
G---------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--S--G--V--N--T--H--R--K--I--H--T--G--E--K--P--Y--K--C--N--D--C--E--K--A--F--N--Q--S--S--A--L--I-
CCACTCAGGCGTTAATACTCATCGAAAAATTCATACTGGAGAAAAACCTTATAAATGTAATGACTGTGAGAAAGCCTTCAACCAAAGCTCAGCTCTAATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--H--Q--R--I--H--T--G--E--K--P--Y--N--C--K--V--C--G--K--A--F--R--Q--S--S--S--L--M--T--H--M--R--I--
CAGCACCAGAGAATTCATACTGGAGAGAAACCATATAATTGTAAAGTGTGTGGGAAAGCCTTCAGACAGAGTTCATCCCTTATGACACACATGAGAATTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------
H--T--G--E--K--P--Y--K--C--K--E--C--G--K--A--F--S--Q--S--S--S--L--T--N--H--Q--R--T--H--N--*-
ATACAGGGGAAAAACCTTATAAATGTAAAGAATGTGGGAAGGCTTTTAGTCAGAGCTCATCTCTTACTAATCATCAAAGGACTCATAATTGA
                                                                                            
--------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000892490
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------ATTCTGTTTTCCAAACCAAAGGTTATCTTCCAATTAGA
GCAAGGGGAAGACCCCTGGATGGTGGAAAATGAAGTTTCTCAA---------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------ACTGGAGATAAGCCCTATAAGTGTAATGAATGTGGGAGAGCCTTTAGCCAGTGCTCATCTCTTATTCAGC
ATCATAGAATTCATACTGGAGAGAAACCATATGAATGTAGTCAGTGTGGGAAAGCCTGTACTTCAATATCACGGCTAAGTAGACACCATAGAATTCATAC
TGGAGAGAAACCCTTTAACTGTAATGAGTGTGGAAAAGTATTCAGTTACCACTCAGCCCTTATTATACATCAGAGAATTCATACTGGTGAGAAACCCTAT
GCGTGTAAAGAATGTGGAAAAGCTTTCAGCCAAAGCTCAGCTCTTATACAACATCAAAGAATTCACACTGGaaAACCGTACAAATGTAATGAATGTGGG-
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------


>BGISUSP0000892490
------------------------------------------------------ILFSKPKVIFQLEQGEDPWMVENEVSQ-------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------TGDKPYKCNECGRAFSQCSSLIQHHRIHTGEKPYECSQCGKACTSISRLSRHHRIHTGEKPFNCNECGKVFSYHSALIIHQRIHTGEKPY
ACKECGKAFSQSSALIQHQRIHTGKPYKCNECG-------------------------------------------------------------------
---------------------------------------------------------------