Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197272 (click for geneview)
Transcript ID ENST00000356897(link to ensembl)
Symbol IL27
Localtion Chromosome:16:28418184:28425656:-1 band: 16p11.2
Description interleukin 27 [Source:RefSeq_peptide;Acc:NP_663634]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------><--------------------------------------------------------------------
-M--G--Q--T--A--G--D--L--G--W--R--L--S--L--L--L--L--P--L--L--L--V--Q--A--G--V--W--G--F--P--R--P--P--
ATGGGCCAGACGGCAGGCGACCTTGGCTGGCGGCTCAGCCTGTTGCTGCTTCCCTTGCTCCTGGTTCAAGCTGGTGTCTGGGGATTCCCAAGGCCCCCAG
                                 :::::::: :::::::::.::::::::::::.::.:::::::::::::::::::::.::::::::::
---------------------------------CTCAGCCTTTTGCTGCTTTCCTTGCTCCTGGCTCGAGCTGGTGTCTGGGGATTCCCGAGGCCCCCAG
----------------------------------L--S--L--L--L--L--S--L--L--L--A--R--A--G--V--W--G--F--P--R--P--P--

----------------------------------------------------------------------------------------------------
G--R--P--Q--L--S--L--Q--E--L--R--R--E--F--T--V--S--L--H--L--A--R--K--L--L--S--E--V--R--G--Q--A--H--R
GGAGGCCCCAGCTGAGCCTGCAGGAGCTGCGGAGGGAGTTCACAGTCAGCCTGCATCTCGCCAGGAAGCTGCTCTCCGAGGTTCGGGGCCAGGCCCACCG
:::::::::  :::::::::::::::.:::.::::::::::: .::::::::::::::::::::::::::::: ::.:::::::::: ::::::::.::.
GGAGGCCCCCCCTGAGCCTGCAGGAGTTGCAGAGGGAGTTCAAGGTCAGCCTGCATCTCGCCAGGAAGCTGCTGTCTGAGGTTCGGGTCCAGGCCCGCCA
G--R--P--P--L--S--L--Q--E--L--Q--R--E--F--K--V--S--L--H--L--A--R--K--L--L--S--E--V--R--V--Q--A--R--H

---><-----------------------------------------------------------------------------------------------
--F--A--E--S--H--L--P--G--V--N--L--Y--L--L--P--L--G--E--Q--L--P--D--V--S--L--T--F--Q--A--W--R--R--L-
CTTTGCGGAATCTCACCTGCCAGGAGTGAACCTGTACCTCCTGCCCCTGGGAGAGCAGCTCCCTGATGTTTCCCTGACCTTCCAGGCCTGGCGCCGCCTC
::::                                                                                                
CTTT------------------------------------------------------------------------------------------------
--F-------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------------------
-S--D--P--E--R--L--C--F--I--S--T--T--L--Q--P--F--H--A--L--L--G--G--L--G--T--Q--G--R--W--T--N--M--E--
TCTGACCCGGAGCGTCTCTGCTTCATCTCCACCACGCTTCAGCCCTTCCATGCCCTGCTGGGAGGGCTGGGGACCCAGGGCCGCTGGACCAACATGGAGA
   :::::.::.:: ::::::::: ::::::. ::.::::. :::::::::.:::::.::::.:::::::::: :::::: . ::::::::.. ..::::
---GACCCAGAACGACTCTGCTTCCTCTCCATGACACTTCGCCCCTTCCATACCCTGTTGGGGGGGCTGGGGAGCCAGGGGTTCTGGACCAGTTCAGAGA
----D--P--E--R--L--C--F--L--S--M--T--L--R--P--F--H--T--L--L--G--G--L--G--S--Q--G--F--W--T--S--S--E--

-------------------------------------------------------------><-------------------------------------
R--M--Q--L--W--A--M--R--L--D--L--R--D--L--Q--R--H--L--R--F--Q--V--L--A--A--G--F--N--L--P--E--E--E--E
GGATGCAGCTGTGGGCCATGAGGCTGGACCTCCGCGATCTGCAGCGGCACCTCCGCTTCCAGGTGCTGGCTGCAGGATTCAACCTCCCGGAGGAGGAGGA
:::::::::::::::::::.::::::::.::::: :::.::::.:.:::.::::::::::::                                      
GGATGCAGCTGTGGGCCATAAGGCTGGATCTCCGAGATTTGCAACAGCATCTCCGCTTCCAG--------------------------------------
R--M--Q--L--W--A--I--R--L--D--L--R--D--L--Q--Q--H--L--R--F--Q---------------------------------------

----------------------------------------------------------------------------------------------------
--E--E--E--E--E--E--E--E--E--R--K--G--L--L--P--G--A--L--G--S--A--L--Q--G--P--A--Q--V--S--W--P--Q--L-
GGAGGAAGAGGAGGAGGAGGAGGAGGAGAGGAAGGGGCTGCTCCCAGGGGCACTGGGCAGCGCCTTACAGGGCCCGGCCCAGGTGTCCTGGCCCCAGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--S--T--Y--R--L--L--H--S--L--E--L--V--L--S--R--A--V--R--E--L--L--L--L--S--K--A--G--H--S--V--W--P--
CTCTCCACCTACCGCCTGCTGCACTCCTTGGAGCTCGTCTTATCTCGGGCCGTGCGGGAGTTGCTGCTGCTGTCCAAGGCTGGGCACTCAGTCTGGCCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------->
L--G--F--P--T--L--S--P--Q--P--*-
TGGGGTTCCCAACATTGAGCCCCCAGCCCTGA
                                
--------------------------------
--------------------------------

Pig Consensus Sequence

>BGISUST0000882579
---------------------------------CTCAGCCTTTTGCTGCTTTCCTTGCTCCTGGCTCGAGCTGGTGTCTGGGGATTCCCGAGGCCCCCAG
GGAGGCCCCCCCTGAGCCTGCAGGAGTTGCAGAGGGAGTTCAAGGTCAGCCTGCATCTCGCCAGGAAGCTGCTGTCTGAGGTTCGGGTCCAGGCCCGCCA
CTTT------------------------------------------------------------------------------------------------
---GACCCAGAACGACTCTGCTTCCTCTCCATGACACTTCGCCCCTTCCATACCCTGTTGGGGGGGCTGGGGAGCCAGGGGTTCTGGACCAGTTCAGAGA
GGATGCAGCTGTGGGCCATAAGGCTGGATCTCCGAGATTTGCAACAGCATCTCCGCTTCCAG--------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------


>BGISUSP0000882579
-----------LSLLLLSLLLARAGVWGFPRPPGRPPLSLQELQREFKVSLHLARKLLSEVRVQARHF--------------------------------
-DPERLCFLSMTLRPFHTLLGGLGSQGFWTSSERMQLWAIRLDLRDLQQHLRFQ----------------------------------------------
--------------------------------------------