Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197414 (click for geneview)
Transcript ID ENST00000357038(link to ensembl)
Symbol Q8N9W7_HUMAN
Localtion Chromosome:15:20294732:20297366:1 band: 15q11.2
Description similar to hypothetical protein FLJ36144 (LOC440318), mRNA
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Y--V--S--I--S--F--L--L--G--L--S--H--L--V--L--C--C--L--L--T--F--I--V--N--F--Y--L--P--P--E--S--I--
ATGTATGTTTCTATTAGTTTTCTTCTTGGTCTTTCTCATTTAGTCTTGTGTTGTCTTTTGACATTCATAGTAAACTTTTATCTGCCTCCAGAGAGTATTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--F--E--F--M--A--H--N--W--S--K--G--R--S--P--S--S--T--L--G--L--S--W--F--K--A--G--F--R--F--S--D--G--W
ACTTTGAGTTTATGGCACACAATTGGAGTAAGGGCAGATCGCCTTCATCTACTTTGGGACTAAGCTGGTTCAAAGCAGGTTTTAGGTTTTCTGATGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--M--F--Y--S--F--G--L--P--G--V--A--L--P--G--S--P--P--R--S--H--L--L--P--G--T--Q--I--L--I--R--S--F-
GTCTATGTTTTATTCATTTGGACTCCCAGGGGTGGCCCTTCCAGGGTCCCCACCAAGGTCCCATCTCCTTCCTGGGACCCAAATTCTCATTAGGTCATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------->
-Q--P--C--E--S--A--K--H--S--A--R--L--S--S--L--L--T--T--T--S--Y--S--V--S--*-
CAGCCCTGTGAGAGTGCCAAACATTCAGCTAGGCTCTCCAGCCTCTTAACTACCACTTCATACTCAGTTTCTTAG
                                                                           
---------------------------------------------------------------------------
---------------------------------------------------------------------------