Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196799 (click for geneview)
Transcript ID ENST00000357211(link to ensembl)
Symbol Q9P1A1_HUMAN
Localtion Chromosome:8:99552782:99557027:1 band: 8q22.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--L--E--L--L--R--T--L--G--F--Y--Y--I--L--H--F--L--G--S--L--I--H--A--L--G--F--K--Y--H--L--S--D--S--
ATGTTAGAACTACTCAGGACTCTGGGCTTTTACTATATACTCCATTTCCTAGGCAGTCTCATACATGCCCTGGGCTTTAAATACCATCTATCTGATAGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--S--N--I--D--L--S--S--E--F--Q--N--L--A--I--L--L--D--V--S--W--V--L--Q--Y--S--V--S--S--Y--L--T--E--T
TCTCTAATATAGATCTGTCTTCTGAGTTCCAGAACTTAGCAATTCTATTAGATGTCTCCTGGGTATTGCAATACTCAGTAAGTTCATATCTGACAGAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------>
--F--*-
CTTCTAA
       
-------
-------