Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196347 (click for geneview)
Transcript ID ENST00000357418(link to ensembl)
Symbol O75198_HUMAN
Localtion Chromosome:16:28618998:28620433:-1 band: 16p11.2
Description PREDICTED: similar to CDC37-like gene
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--L--G--G--S--T--T--S--L--R--T--T--V--Q--G--V--S--W--V--A--E--A--K--C--W--T--T--A--C--G--A--T--
ATGGCCCTAGGGGGCAGTACTACCTCACTGAGAACCACTGTTCAGGGAGTTAGCTGGGTCGCAGAGGCAAAATGTTGGACTACAGCGTGTGGGGCCACAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--S--D--D--E--E--E--R--H--P--N--T--H--R--A--N--L--F--R--W--Q--H--Q--A--R--V--E--L--M--E--Q--F--Q--K
TGAGCGATGATGAAGAGGAGAGGCATCCCAACACCCACCGGGCTAACCTCTTCCGCTGGCAGCACCAAGCCCGGGTGGAGCTCATGGAGCAGTTCCAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--K--E--E--L--D--R--G--C--W--E--Y--K--C--K--M--A--E--C--Q--R--K--L--K--E--L--E--V--S--E--G--A--R-
GGAGAAGGAGGAACTGGACAGGGGCTGCTGGGAGTACAAGTGCAAGATGGCCGAGTGCCAGAGGAAGCTGAAGGAGCTGGAGGTGTCAGAGGGTGCCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--E--V--E--W--L--H--E--E--L--S--W--E--Q--K--L--E--E--M--P--K--K--K--S--M--T--W--N--V--D--T--L--S--
GTGGAGGTGGAGTGGCTACACGAGGAGCTGAGCTGGGAGCAAAAGCTGGAGGAGATGCCCAAGAAAAAGAGCATGACCTGGAACGTGGACACGCTCAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------><----------------------------------------------------------------------------
K--S--S--F--R--L--G--E--M--D--P--T--K--A--K--F--P--M--Q--Q--C--I--D--A--G--L--R--V--P--N--S--E--V--S
AAAGCAGTTTCAGGCTGGGTGAGATGGACCCCACCAAGGCCAAGTTCCCCATGCAGCAGTGTATCGACGCCGGCCTCCGGGTCCCCAACTCTGAGGTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--A--K--E--G--E--E--E--C--S--G--T--G--C--W--K--L--F--P--R--Q--A--G--M--S--V--R--D--P--P--Q--L--Q-
CGAGGCCAAGGAGGGAGAGGAGGAGTGTTCAGGGACCGGCTGCTGGAAGCTGTTCCCAAGACAGGCGGGGATGTCAGTGCGTGACCCACCCCAGCTGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--P--P--V--C--K--P--L--G--A--P--F--Q--K--T--K--I--D--T--I--S--P--A--P--G--F--L--H--F--R--C--S--P--
CTGCCACCTGTGTGCAAGCCCCTAGGCGCCCCTTTTCAGAAAACAAAAATAGACACCATCTCCCCAGCTCCTGGCTTCCTCCACTTCCGCTGCTCCCCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

->
*-
AG
  
--
--