Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196680 (click for geneview)
Transcript ID ENST00000357589(link to ensembl)
Symbol Q8WZ27_HUMAN
Localtion Chromosome:4:38450595:38488996:-1 band: 4p14
Description Hypothetical protein.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--G--L--G--A--V--E--Q--E--A--A--L--A--G--E--A--P--A--A--Q--V--P--T--E--G--V--G--G--S--G--M--A--G--
ATGGGACTGGGCGCTGTGGAGCAGGAGGCGGCGCTTGCTGGGGAGGCTCCTGCGGCACAGGTGCCCACGGAGGGGGTGGGAGGCTCAGGCATGGCGGGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
C--R--S--R--A--L--P--L--G--K--A--A--R--A--P--G--E--I--E--R--S--A--G--G--S--A--L--L--G--D--P--V--H--P
GCAGGTCCCGAGCCCTGCCCCTTGGGAAGGCAGCTAGGGCCCCGGGAGAAATCGAGCGCAGCGCCGGTGGGTCAGCACTGCTGGGGGACCCAGTACACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--Q--P--L--A--R--V--L--S--P--S--L--P--G--A--G--R--A--C--R--L--L--R--V--R--A--A--K--L--T--P--T--Q-
TCCACAGCCACTGGCTCGGGTGCTAAGCCCCTCATTGCCTGGGGCCGGCAGGGCCTGCCGGCTGCTCCGAGTGCGGGCCGCCAAGCTCACACCCACCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--S--S--W--P--A--S--V--A--C--S--P--G--S--C--S--H--L--S--L--H--T--S--L--Q--A--E--G--A--G--S--G--L--
AACTCCAGCTGGCCTGCAAGCGTCGCGTGCAGCCCCGGTTCCTGCTCGCACCTCTCCCTCCACACCTCCCTGCAAGCTGAGGGAGCCGGCTCCGGCCTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--K--P--R--K--G--L--P--Q--C--S--G--G--L--K--G--S--S--S--A--A--K--V--G--A--Q--A--E--E--A--P--R--A--S
GCAAGCCCAGAAAGGGGCTCCCACAGTGCAGCGGTGGGCTGAAGGGCTCCTCAAGTGCCGCCAAAGTGGGAGCCCAGGCAGAGGAGGCACCGAGAGCGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------>
--E--G--S--E--D--C--Q--H--A--V--T--S--H--*-
TGAGGGCTCTGAGGACTGCCAGCACGCTGTCACCTCTCACTAG
                                           
-------------------------------------------
-------------------------------------------