Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198602 (click for geneview)
Transcript ID ENST00000357644(link to ensembl)
Symbol Q8N6I5_HUMAN
Localtion Chromosome:4:36080721:36097457:1 band: 4p14
Description PREDICTED: hypothetical protein XP_498443
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--K--A--K--L--F--L--P--T--C--S--L--P--C--L--F--A--S--C--C--I--W--P--L--K--G--K--V--K--G--K--R--
ATGGAGAAGGCTAAACTTTTTCTTCCCACATGCTCACTTCCTTGCTTGTTCGCTAGCTGCTGCATCTGGCCCCTCAAGGGTAAAGTCAAGGGGAAAAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------><----------------------------------------------------------------------
R--L--R--G--R--T--V--C--E--L--G--L--T--V--F--P--R--L--K--Y--S--V--V--I--S--V--H--C--N--F--C--L--L--S
GATTGAGAGGAAGGACAGTCTGTGAATTGGGTCTCACCGTGTTTCCCAGGCTGAAGTACAGTGTTGTGATATCAGTTCATTGCAACTTCTGTCTTCTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--S--N--P--L--A--S--A--S--Q--V--A--G--T--D--Y--R--H--E--P--P--H--L--A--N--F--F--C--I--F--V--E--K-
CTCAAGCAATCCTCTTGCCTCAGCCTCTCAAGTAGCTGGGACTGACTACAGGCATGAACCACCACACCTGGCTAATTTTTTTTGTATTTTTGTCGAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------><--------------------------------->
-T--V--S--P--C--C--T--E--L--L--L--K--S--L--F--T--S--W--*-
ACAGTTTCGCCATGTTGTACAGAACTACTTCTCAAATCACTATTCACATCCTGGTAG
                                                         
---------------------------------------------------------
---------------------------------------------------------