Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196993 (click for geneview)
Transcript ID ENST00000357796(link to ensembl)
Symbol NP_001018069.1
Localtion Chromosome:16:28677526:28691577:1 band: 16p11.2
Description PREDICTED: similar to nuclear pore complex interacting protein
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------------><---------------------------------
-M--R--L--R--F--W--L--L--I--W--L--L--L--G--F--I--S--H--Q--P--T--P--V--S--F--L--K--T--I--F--W--S--R--
ATGCGGCTGCGCTTTTGGCTCCTCATTTGGCTCCTGCTGGGATTTATCAGCCATCAGCCCACCCCTGTGTCTTTCCTGAAGACTATCTTCTGGTCTCGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
N--G--H--D--G--S--M--D--V--Q--Q--R--A--W--R--S--N--R--S--R--Q--K--G--L--R--S--I--C--M--H--T--K--K--R
ATGGACATGATGGATCCATGGATGTACAGCAGAGAGCCTGGAGGTCCAACCGCAGTAGACAGAAAGGGCTGAGGTCCATTTGTATGCACACAAAGAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--S--S--F--R--G--N--K--I--G--L--K--D--V--I--T--L--R--R--H--V--E--T--K--V--R--A--K--I--R--K--R--K-
AGTTTCTTCCTTTCGAGGAAATAAAATTGGCCTGAAAGACGTCATTACTCTACGGAGGCATGTGGAAACAAAAGTTAGAGCTAAAATCCGTAAGAGGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><-------------------------------------
-V--T--T--K--I--N--R--H--D--K--I--N--G--K--R--K--T--A--R--K--Q--K--M--F--Q--R--A--Q--E--L--R--R--R--
GTGACAACGAAAATCAACCGTCATGACAAAATCAATGGAAAGAGGAAGACCGCCAGAAAACAGAAAATGTTTCAACGTGCGCAAGAGTTGCGGCGGCGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------><----------------------------------><----------------------------------------
A--E--D--Y--H--K--C--K--I--P--P--S--A--R--K--P--L--C--N--W--V--R--M--A--A--A--E--H--R--H--S--S--G--L
CAGAGGACTACCACAAATGCAAAATCCCCCCTTCTGCAAGAAAGCCTCTTTGCAACTGGGTCAGAATGGCGGCAGCGGAGCATCGTCATTCTTCAGGATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--Y--W--L--Y--L--T--A--E--T--L--K--N--R--M--G--R--Q--P--P--P--P--T--Q--Q--H--S--I--T--D--N--S--L-
GCCCTACTGGCTCTACCTCACAGCTGAAACTTTAAAAAACAGGATGGGCCGCCAGCCACCTCCTCCAACTCAACAACATTCTATAACTGATAACTCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--L--K--T--P--P--E--C--L--L--T--P--L--P--P--S--V--D--D--N--I--K--E--C--P--L--A--P--L--P--P--S--P--
AGCCTCAAGACACCTCCTGAGTGTCTGCTCACTCCCCTTCCACCCTCAGTGGATGATAATATCAAGGAGTGTCCTCTTGCTCCTCTTCCACCCTCTCCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--P--P--S--V--D--D--N--L--K--E--C--L--F--V--P--L--P--P--S--P--L--P--P--S--V--D--D--N--L--K--E--C--L
TTCCACCCTCAGTGGATGATAATCTGAAGGAATGTCTCTTTGTCCCGCTTCCACCCTCTCCTCTTCCACCCTCAGTGGATGATAATCTGAAGGAATGTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--V--P--L--P--P--S--P--L--P--P--S--V--D--D--N--L--K--T--P--P--L--A--T--Q--E--A--E--V--E--K--P--P-
CTTTGTCCCGCTTCCACCCTCTCCTCTTCCACCCTCAGTGGATGATAATCTCAAGACTCCTCCCTTAGCTACTCAGGAGGCCGAGGTGGAAAAACCACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--P--K--R--W--R--V--D--E--V--E--Q--S--P--K--P--K--R--Q--R--E--A--E--A--Q--Q--L--P--K--P--K--R--R--
AAACCCAAGAGGTGGAGGGTGGATGAGGTGGAACAATCGCCCAAGCCCAAGAGGCAGAGGGAGGCCGAGGCACAACAATTACCCAAACCCAAGAGGCGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------->
R--L--S--K--L--R--T--R--H--C--T--Q--A--W--A--I--R--I--N--P--*-
GGTTGAGTAAGCTGAGAACACGCCATTGCACTCAAGCCTGGGCAATAAGAATAAATCCGTAG
                                                              
--------------------------------------------------------------
--------------------------------------------------------------