Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196506 (click for geneview)
Transcript ID ENST00000357810(link to ensembl)
Symbol Q9NS32_HUMAN
Localtion Chromosome:5:103587343:103587705:-1 band: 5q21.2
Description HDCGC21P.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--A--G--G--M--E--G--L--K--T--E--G--R--A--A--S--P--G--P--E--W--G--I--L--L--P--L--P--G--L--P--L--
ATGGCAGCAGGAGGCATGGAGGGCCTGAAGACTGAGGGCCGGGCTGCCAGTCCCGGACCAGAGTGGGGAATACTTCTGCCTCTTCCGGGCCTGCCCCTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--A--H--G--P--I--H--R--H--F--L--P--S--E--A--C--K--S--P--G--L--S--Q--T--K--A--E--D--H--Q--K--L--R--E
CTGCCCATGGGCCAATCCACAGGCACTTCCTCCCTTCTGAGGCCTGTAAAAGTCCTGGGCTTAGTCAGACAAAGGCAGAGGACCACCAGAAGTTAAGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--E--R--D--V--F--G--R--D--D--Q--L--Q--R--A--V--P--S--L--L--I--A--G--M--T--S--C--R--E--E--Y--S--R-
GGCAGAGAGAGATGTCTTTGGCAGGGACGACCAGCTGCAGAGAGCAGTACCTTCTCTGCTGATAGCTGGGATGACCAGCTGCAGAGAGGAGTATTCGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------->
-S--T--H--S--A--E--N--C--R--D--D--L--P--A--E--R--S--Y--P--L--*-
AGTACCCACTCTGCTGAGAACTGCAGAGACGATCTGCCAGCAGAGAGGAGCTACCCTCTCTGA
                                                               
---------------------------------------------------------------
---------------------------------------------------------------