Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198190 (click for geneview)
Transcript ID ENST00000357826(link to ensembl)
Localtion Chromosome:18:21955473:21957908:1 band: 18q11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-N--S--K--S--Q--S--A--L--F--H--P--N--D--H--N--T--S--P--A--R--V--L--N--W--A--E--A--E--M--A--E--M--T--
AACTCAAAAAGCCAGAGTGCCCTCTTTCATCCAAATGACCACAACACCTCCCCAGCAAGGGTTCTGAACTGGGCTGAGGCTGAGATGGCTGAAATGACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--T--G--F--R--M--W--I--K--M--N--F--S--E--L--K--E--H--V--A--T--E--G--K--E--A--K--N--H--D--K--T--M--Q
AAACAGGCTTCAGAATGTGGATAAAAATGAACTTCAGTGAGCTAAAGGAGCATGTTGCAACCGAAGGCAAGGAAGCCAAGAATCATGATAAAACAATGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--L--T--A--K--I--A--R--I--E--R--N--I--T--D--L--I--E--L--K--N--T--L--Q--E--L--H--N--A--I--T--S--I-
AGAGCTGACAGCCAAAATAGCCAGAATAGAGAGGAACATAACTGACCTGATAGAGCTGAAAAACACACTACAAGAACTTCACAATGCAATTACAAGCATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------><--------------------------------
-N--S--R--I--D--Q--V--E--K--R--I--S--E--L--E--D--C--L--S--E--M--T--D--R--P--K--F--K--F--R--K--S--R--
AACAGCAGAATAGACCAAGTGGAGAAAAGAATCTCAGAGCTTGAAGACTGTCTTTCTGAAATGACAGACAGGCCAAAATTCAAATTCAGGAAATCCAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------><-------------------------------------------------------------------------->
E--P--H--V--A--I--P--Q--R--S--R--D--R--N--S--I--Q--P--S--N--P--I--T--G--Y--M--P--K-
AACCCCATGTGGCAATTCCTCAAAGATCTAGAGACAGAAATAGTATTCAACCCAGCAATCCCATTACTGGGTATATGCCCAAA
                                                                                   
-----------------------------------------------------------------------------------
-----------------------------------------------------------------------------------