Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000175676 (click for geneview)
Transcript ID ENST00000358142(link to ensembl)
Localtion Chromosome:15:20986537:21161461:1 band: 15q11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------------><------------------------------------
-M--E--W--K--L--E--Q--S--M--R--E--Q--A--L--L--K--A--Q--L--T--Q--L--K--E--S--L--K--E--V--Q--L--E--R--
ATGGAGTGGAAGTTAGAGCAGTCCATGCGGGAGCAGGCACTGCTGAAAGCGCAGCTGACACAGTTGAAGGAGTCACTTAAAGAAGTCCAGCTAGAGAGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------><----------------------------
D--E--Y--A--E--H--L--K--G--E--R--A--R--W--Q--Q--R--M--R--K--M--S--Q--E--V--C--S--L--K--K--E--K--K--H
ATGAATATGCTGAACATCTAAAAGGAGAGAGGGCCCGGTGGCAGCAGAGGATGAGAAAAATGTCGCAGGAGGTTTGCTCGTTGAAGAAGGAGAAGAAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
--D--K--Y--R--V--E--T--L--E--R--S--L--S--K--L--K--H--Q--M--A--E--P--L--P--P--E--P--P--A--V--P--S--E-
TGATAAATATCGGGTAGAGACGCTGGAGAGGAGCTTGTCCAAACTCAAACACCAGATGGCTGAACCCTTGCCCCCGGAGCCCCCAGCAGTGCCCTCTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--E--L--Q--H--L--R--K--E--L--E--R--V--A--G--A--L--Q--A--Q--V--E--Y--N--Q--R--I--S--L--L--N--E--G--
GTGGAGCTGCAGCACCTGAGGAAGGAACTAGAGAGAGTGGCAGGAGCGCTCCAGGCCCAGGTGGAGTACAATCAGCGCATAAGTCTCCTGAATGAGGGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------><--------------------------------------------
Q--K--E--R--L--R--E--Q--E--E--R--L--Q--E--Q--Q--E--R--L--V--F--L--Q--V--E--L--K--S--Q--E--A--Q--S--L
AAAAGGAGAGACTTCGGGAGCAGGAGGAGAGGCTTCAGGAGCAGCAGGAGAGGCTGGTCTTCCTGCAGGTGGAGCTGAAGAGCCAAGAGGCTCAGAGTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--Q--Q--P--D--H--Y--L--G--H--L--Q--Q--Y--V--A--T--Y--Q--Q--Q--V--A--A--Y--Q--Q--L--T--C--E--K--E-
GCAGCAGCAGCCAGACCATTACCTGGGTCACCTGCAGCAGTACGTGGCCACCTATCAGCAGCAGGTGGCCGCCTATCAGCAGCTGACCTGTGAGAAGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------><------------------------
-A--L--Y--R--Q--W--L--Q--Q--T--Q--L--M--N--Q--L--Q--Q--Q--E--A--W--G--K--A--E--R--L--E--A--A--S--Q--
GCGCTGTACAGGCAGTGGCTGCAGCAGACCCAGCTAATGAACCAGTTGCAGCAGCAGGAAGCTTGGGGCAAAGCGGAGCGTCTGGAAGCTGCCAGCCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><------------------------------------------------
Q--K--Q--Q--L--T--A--Q--L--S--L--M--A--L--P--G--E--G--D--G--G--G--H--L--D--S--E--G--E--E--A--P--R--P
AGAAACAGCAGCTAACGGCCCAGTTGAGCCTCATGGCTCTCCCTGGGGAAGGAGATGGAGGAGGACATCTGGACAGTGAGGGGGAGGAGGCACCTCGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------><--------------------------------------------------------
--I--P--S--I--P--Q--D--L--E--S--R--E--A--M--V--A--F--F--K--S--A--G--A--S--A--Q--E--K--Q--A--Q--L--Q-
CATTCCTAGCATCCCACAGGACCTGGAGAGCAGGGAGGCCATGGTGGCATTTTTCAAGTCCGCTGGAGCTAGTGCCCAGGAGAAGCAGGCACAGTTACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
-E--Q--V--K--E--Q--R--V--C--Q--R--L--A--H--L--V--A--S--A--Q--K--E--P--E--A--A--R--G--P--G--A--P--G--
GAGCAGGTGAAAGAGCAGAGGGTGTGCCAGCGCCTGGCTCACCTGGTGGCCTCGGCCCAGAAGGAGCCAGAGGCAGCCAGAGGCCCTGGAGCCCCAGGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--G--G--E--S--V--S--G--E--T--H--W--A--L--Q--E--V--T--E--K--L--A--H--A--R--T--H--L--H--L--L--H--D--L
CTGGGGGCGAGTCTGTGAGTGGGGAGACCCACTGGGCCCTGCAGGAAGTCACGGAGAAGCTGGCCCATGCCAGGACTCACCTCCACCTTCTCCATGACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------><
--K--M--P--P--E--G--R--S--L--P--R--C--D--Y--N--I--L--A--P--E--Q--L--Y--G--P--P--G--G--E--G--R--P--E-
GAAAATGCCACCTGAGGGCAGGTCGCTGCCGAGATGTGACTACAATATTTTGGCTCCAGAGCAGCTTTATGGACCACCTGGAGGAGAAGGCAGACCTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------------><--
-K--I--H--H--L--L--S--E--P--G--G--R--A--K--D--A--A--L--G--G--G--H--H--Q--A--G--A--Q--G--G--D--E--D--
AAAATCCATCACCTTTTATCAGAACCAGGGGGCCGTGCCAAAGATGCGGCACTGGGAGGAGGACACCATCAGGCTGGAGCTCAGGGAGGAGATGAAGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--A--A--G--A--A--A--D--G--I--A--A--Y--S--N--Y--N--N--G--H--R--K--F--L--A--A--A--H--N--P--A--D--E--P
AAGCTGCTGGAGCTGCAGCAGATGGTATTGCGGCTTACAGCAACTACAACAATGGGCACAGAAAATTCCTGGCCGCTGCCCACAACCCTGCTGATGAGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------->
--G--P--G--A--P--A--P--Q--E--L--G--A--A--D--K--H--G-
CGGTCCAGGAGCCCCAGCCCCCCAGGAGCTTGGGGCTGCAGACAAGCATGGT
                                                    
----------------------------------------------------
----------------------------------------------------