Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000139973 (click for geneview)
Transcript ID ENST00000358254(link to ensembl)
Symbol SYT14L
Localtion Chromosome:14:61532294:61638177:1 band: 14q23.2
Description synaptotagmin XIV-like [Source:RefSeq_peptide;Acc:NP_114120]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--V--L--A--M--A--S--Q--D--V--Q--N--F--F--Q--P--F--S--S--W--I--S--R--V--Y--E--A--L--Q--Q--A--G--D--
ATGGTGTTGGCCATGGCGTCTCAGGATGTTCAGAACTTCTTCCAGCCTTTCTCTTCCTGGATATCTCGGGTTTATGAAGCTCTCCAGCAAGCAGGAGATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
M--L--S--A--S--L--V--N--I--S--K--Q--D--S--K--L--S--D--K--L--D--Q--D--L--D--N--I--Q--I--Q--E--T--Y--F
TGTTATCTGCTTCGCTGGTTAACATAAGCAAACAAGACTCTAAATTGAGTGACAAACTAGATCAGGACTTAGATAATATTCAGATTCAGGAAACGTACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--D--E--E--Q--D--N--D--W--S--Q--E--D--A--N--S--L--F--L--E--V--D--H--F--S--C--C--N--S--D--L--Q--D-
TGAAGATGAAGAACAAGACAATGATTGGAGTCAAGAGGATGCAAATTCCTTGTTTCTTGAAGTGGATCATTTCTCATGTTGTAATAGTGATTTGCAGGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--A--Q--N--S--S--P--S--L--S--Q--H--A--K--D--S--C--S--T--M--S--Q--W--P--N--W--A--S--D--D--R--K--L--
TCTGCCCAAAATTCAAGCCCAAGCCTTAGCCAACATGCAAAGGACTCATGTTCCACAATGTCCCAGTGGCCCAATTGGGCCAGTGATGACCGCAAGTTAC
                                                                     ::.:.:..:.::  ::::::::. :::..::
---------------------------------------------------------------------CCTAGTCAGACCCTTGATGACCAAAAGCCAC
----------------------------------------------------------------------P--S--Q--T--L--D--D--Q--K--P--

----------------------------------------------------------------------------------------------------
P--H--V--L--S--S--I--A--E--E--E--H--H--L--E--K--Q--R--S--G--L--Q--H--G--F--D--S--Q--L--P--G--T--L--E
CACATGTGCTTTCTTCTATTGCGGAGGAAGAGCATCACCTTGAAAAGCAAAGAAGTGGCCTTCAACATGGCTTTGACAGCCAGCTCCCTGGTACTTTAGA
:::::::::::::::::::::: :: :::::.::::::::::.:::::::::.::::::::::::::::.::::::..:.::::::.::::::.::::::
CACATGTGCTTTCTTCTATTGCTGATGAAGAACATCACCTTGGAAAGCAAAGGAGTGGCCTTCAACATGACTTTGATGGTCAGCTCTCTGGTATTTTAGA
P--H--V--L--S--S--I--A--D--E--E--H--H--L--G--K--Q--R--S--G--L--Q--H--D--F--D--G--Q--L--S--G--I--L--E

----------------------><----------------------------------------------------------------------------
--T--V--N--G--K--K--Q--V--N--S--F--G--D--D--E--E--L--S--T--S--S--D--S--D--E--E--V--I--K--Q--F--E--I-
AACTGTTAATGGAAAAAAGCAAGTCAACAGCTTTGGGGATGACGAAGAGCTGTCCACATCTTCTGACAGTGACGAGGAGGTGATCAAACAATTTGAGATT
:: :::::::::::::::::::                                                                              
AAATGTTAATGGAAAAAAGCAA------------------------------------------------------------------------------
--N--V--N--G--K--K--Q-------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--V--S--R--S--Q--S--F--R--S--V--T--S--E--K--G--K--Q--T--G--L--E--Q--K--P--K--F--S--R--S--L--L--T--
TCCGTGTCCCGGTCCCAGAGTTTCCGTTCAGTGACATCTGAGAAAGGAAAGCAGACAGGATTGGAGCAGAAACCAAAATTCAGCCGTTCGTTGTTGACAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------><---------------------------------------------------------------
H--G--E--D--G--T--E--V--S--A--C--E--D--L--D--G--A--S--Q--R--R--Y--S--E--N--L--S--Y--G--E--D--D--H--I
ACGGAGAAGATGGCACAGAAGTATCTGCCTGCGAAGATTTGGATGGAGCCAGCCAACGGCGTTATTCTGAGAATCTCTCCTACGGTGAAGATGACCACAT
                                      ::::::::::::::::::: . .:::::::::: :::: :: ::.::::::::::.:: :::
--------------------------------------TTGGATGGAGCCAGCCAACCAAATTATTCTGAGCATCTGTCATATGGTGAAGATGGCCCCAT
---------------------------------------L--D--G--A--S--Q--P--N--Y--S--E--H--L--S--Y--G--E--D--G--P--I

----------------------------------------------------------------------------------------------------
--P--A--H--S--Q--S--P--C--E--R--G--D--A--K--H--H--G--T--S--H--Q--E--S--S--V--V--Q--S--L--R--R--Q--S-
CCCTGCTCACTCACAGTCCCCATGTGAAAGAGGGGATGCCAAACACCACGGCACATCTCACCAAGAGTCCAGTGTGGTCCAAAGCCTCAGGCGCCAATCC
:.::::.::::::..:::::::: :::.  .:::::..:::..:: :: :::::::::: ::::::: :: :::::::::.  ::::::: :: ::.:::
CTCTGCCCACTCATGGTCCCCATCTGAGCTGGGGGACACCAGGCAACAGGGCACATCTCCCCAAGAGACCTGTGTGGTCCGCTGCCTCAGCCGGCAGTCC
--S--A--H--S--W--S--P--S--E--L--G--D--T--R--Q--Q--G--T--S--P--Q--E--T--C--V--V--R--C--L--S--R--Q--S-

-------------------------------------------------------------------------------><-------------------
-T--E--G--S--L--E--M--E--T--A--F--N--S--R--G--F--E--D--S--Y--A--T--D--S--S--S--M--T--N--L--Q--V--P--
ACAGAGGGCAGCTTGGAGATGGAGACAGCTTTTAATAGCCGGGGATTTGAAGATTCCTATGCCACTGACAGCTCCTCCATGACCAATTTGCAGGTGCCAT
:: :::::::::::::::::::::.::::::::::::.:::.::::::::::::::::::::::::::::::::::::                      
ACTGAGGGCAGCTTGGAGATGGAGGCAGCTTTTAATAACCGAGGATTTGAAGATTCCTATGCCACTGACAGCTCCTCC----------------------
-T--E--G--S--L--E--M--E--A--A--F--N--N--R--G--F--E--D--S--Y--A--T--D--S--S--S-----------------------

----------------------------------------------------------------------------------------------------
S--G--V--S--E--P--I--S--K--C--G--D--L--D--V--I--F--E--Y--R--A--A--S--Q--K--L--T--V--T--I--V--R--A--Q
CCGGGGTCTCAGAGCCCATCTCAAAGTGTGGTGACCTAGATGTCATCTTTGAATATAGAGCCGCCAGCCAGAAGCTCACAGTGACCATTGTGAGGGCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--L--P--D--K--D--R--S--G--V--N--S--W--Q--V--H--V--V--L--L--P--G--K--K--H--R--G--R--T--N--I--Q--R-
GGGCCTCCCAGATAAGGACCGAAGTGGTGTCAACTCCTGGCAAGTTCATGTAGTGCTGCTGCCTGGTAAGAAACACAGGGGCAGGACGAACATACAGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--P--N--P--V--F--R--E--K--V--T--F--A--K--L--E--P--R--D--V--A--A--C--A--V--R--F--R--L--Y--A--A--R--
GGGCCCAACCCCGTCTTCAGGGAGAAGGTCACCTTTGCCAAGCTGGAGCCCAGAGATGTGGCTGCCTGTGCTGTCCGCTTCCGCCTGTACGCTGCCCGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--M--T--R--E--R--M--M--G--E--K--L--F--Y--L--S--H--L--H--P--E--G--E--M--K--V--T--L--V--L--E--P--R--S
AGATGACCCGAGAGAGAATGATGGGAGAGAAACTATTCTATCTCAGCCACCTGCACCCAGAAGGGGAAATGAAAGTGACTCTGGTTCTGGAGCCAAGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------><-----------------------------------------------------------------------------------------
--N--I--S--S--G--G--S--P--L--S--P--S--A--V--S--H--S--D--S--T--S--S--T--Q--S--L--S--H--G--G--A--P--E-
TAATATAAGCAGTGGAGGGTCTCCGCTCAGCCCATCTGCGGTTTCTCACAGTGATAGTACTTCATCCACGCAGTCGCTGTCTCATGGAGGGGCGCCAGAG
             ::::.::::::::::::::::::::: ::::::::::::::.:::.:::::::::::::::::::::: ::::::::::::::::::
-------------GGAGAGTCTCCGCTCAGCCCATCTGCCGTTTCTCACAGTGACAGTGCTTCATCCACGCAGTCGCTGTCGCATGGAGGGGCGCCAGAG
--------------G--E--S--P--L--S--P--S--A--V--S--H--S--D--S--A--S--S--T--Q--S--L--S--H--G--G--A--P--E-

--------------------------------------------------------------------------------------------------->
-L--L--V--G--L--S--Y--N--A--T--T--G--R--L--S--V--E--M--I--K--G--S--H--F--R--N--L--A--V--N--R--A--P--
CTGTTGGTGGGGCTCTCGTACAATGCCACAACGGGGCGATTATCTGTGGAAATGATCAAAGGCAGCCATTTCCGAAACCTCGCTGTTAACCGAGCACCTG
:::::.:::::.:: ::.::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: :::::::: :::: ::: 
CTGTTAGTGGGACTGTCATACAATGCCACAACGGGGCGATTATCTGTGGAAATGATCAAAGGCAGCCATTTCCGAAACCTCTCTGTTAACAGAGCTCCT-
-L--L--V--G--L--S--Y--N--A--T--T--G--R--L--S--V--E--M--I--K--G--S--H--F--R--N--L--S--V--N--R--A--P--

<---------------------------------------------------------------------------------------------------
D--T--Y--G--K--L--F--L--L--N--S--V--G--Q--E--M--S--R--C--K--T--S--I--R--R--G--Q--P--N--P--V--Y--K--E
ATACATATGGAAAACTCTTTCTCCTCAATTCTGTGGGTCAAGAGATGTCCCGTTGCAAGACGTCCATTCGGCGTGGTCAGCCCAATCCTGTCTATAAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--F--V--F--Q--V--A--L--F--Q--L--S--D--V--T--L--M--I--S--V--Y--N--R--R--T--M--K--R--K--E--M--I--G-
GACCTTTGTTTTCCAGGTGGCCCTCTTTCAGCTGTCTGATGTCACGTTGATGATTTCCGTTTATAACAGGCGTACTATGAAGCGTAAAGAGATGATTGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-W--I--A--L--G--Q--N--S--S--G--E--E--E--Q--D--H--W--E--E--M--K--E--T--K--G--Q--Q--I--C--R--W--H--T--
TGGATTGCCCTGGGCCAGAACAGCAGTGGAGAGGAGGAACAAGATCACTGGGAGGAGATGAAGGAAACCAAAGGCCAGCAGATCTGCAGATGGCACACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------->
L--L--E--S--*-
TGCTGGAATCCTAG
              
--------------
--------------

Pig Consensus Sequence

>BGISUST0000899984
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------------CCTAGTCAGACCCTTGATGACCAAAAGCCAC
CACATGTGCTTTCTTCTATTGCTGATGAAGAACATCACCTTGGAAAGCAAAGGAGTGGCCTTCAACATGACTTTGATGGTCAGCTCTCTGGTATTTTAGA
AAATGTTAATGGAAAAAAGCAA------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------TTGGATGGAGCCAGCCAACCAAATTATTCTGAGCATCTGTCATATGGTGAAGATGGCCCCAT
CTCTGCCCACTCATGGTCCCCATCTGAGCTGGGGGACACCAGGCAACAGGGCACATCTCCCCAAGAGACCTGTGTGGTCCGCTGCCTCAGCCGGCAGTCC
ACTGAGGGCAGCTTGGAGATGGAGGCAGCTTTTAATAACCGAGGATTTGAAGATTCCTATGCCACTGACAGCTCCTCC----------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------GGAGAGTCTCCGCTCAGCCCATCTGCCGTTTCTCACAGTGACAGTGCTTCATCCACGCAGTCGCTGTCGCATGGAGGGGCGCCAGAG
CTGTTAGTGGGACTGTCATACAATGCCACAACGGGGCGATTATCTGTGGAAATGATCAAAGGCAGCCATTTCCGAAACCTCTCTGTTAACAGAGCTCCT-
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------


>BGISUSP0000899984
----------------------------------------------------------------------------------------------------
-----------------------PSQTLDDQKPPHVLSSIADEEHHLGKQRSGLQHDFDGQLSGILENVNGKKQ--------------------------
----------------------------------------------LDGASQPNYSEHLSYGEDGPISAHSWSPSELGDTRQQGTSPQETCVVRCLSRQS
TEGSLEMEAAFNNRGFEDSYATDSSS--------------------------------------------------------------------------
-----------------------------------------------------------------------GESPLSPSAVSHSDSASSTQSLSHGGAPE
LLVGLSYNATTGRLSVEMIKGSHFRNLSVNRAP-------------------------------------------------------------------
--------------------------------------