Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000186417 (click for geneview)
Transcript ID ENST00000358542(link to ensembl)
Symbol COLM
Localtion Chromosome:15:49421169:49485509:1 band: 15q21.2
Description collomin [Source:RefSeq_peptide;Acc:NP_861454]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------><----------------><--------------------------------------
-M--V--D--L--C--N--S--T--K--G--I--C--L--T--G--P--S--G--P--P--G--P--P--G--A--G--G--L--P--G--H--N--G--
ATGGTGGACCTGTGCAACAGCACCAAGGGCATCTGCCTCACAGGACCTTCTGGACCACCAGGACCTCCGGGAGCCGGCGGGTTGCCAGGACACAACGGAT
                                                               :::::.:::...::.:::::.::::::::::::::::
---------------------------------------------------------------CCTCCAGGAATTGGTGGGTTACCAGGACACAACGGAT
----------------------------------------------------------------P--P--G--I--G--G--L--P--G--H--N--G--

--------------------------------------------------------------------><------------------------------
L--D--G--Q--P--G--P--Q--G--P--K--G--E--K--G--A--N--G--K--R--G--K--M--G--I--P--G--A--A--G--N--P--G--E
TGGATGGACAGCCTGGTCCTCAGGGCCCAAAAGGAGAAAAAGGAGCAAATGGAAAAAGAGGAAAAATGGGGATACCTGGAGCTGCAGGAAATCCAGGGGA
.::::::::::::::::::.:::::::::::::: :::::::::::::::::::::::::::::::::                                
CGGATGGACAGCCTGGTCCCCAGGGCCCAAAAGGCGAAAAAGGAGCAAATGGAAAAAGAGGAAAAATG--------------------------------
S--D--G--Q--P--G--P--Q--G--P--K--G--E--K--G--A--N--G--K--R--G--K--M---------------------------------

----------------------------------------------------------------------------------------------------
--R--G--E--K--G--D--H--G--E--L--G--L--Q--G--N--E--G--P--P--G--Q--K--G--E--K--G--D--K--G--D--V--S--N-
AAGGGGAGAAAAGGGAGACCATGGTGAACTGGGCCTGCAGGGAAATGAGGGCCCACCAGGGCAGAAGGGAGAAAAGGGTGACAAAGGAGATGTGTCCAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><-----------------------------------------------------------------------------------
-D--V--L--L--A--G--A--K--G--D--Q--G--P--P--G--P--P--G--P-----------P--G--P--P--G--P--P--G--P--P--G--
GACGTGCTCCTGGCAGGTGCCAAAGGTGACCAAGGCCCACCCGGTCCACCTGGGCCC---------CCAGGCCCTCCAGGTCCTCCAGGGCCCCCTGGAA
                  ::::::::.::::::::::::::.::.::::: :: :::         :::::::::::.:::::.::::::::::::::::
------------------GCCAAAGGCGACCAAGGCCCACCTGGCCCACCAGGCCCCGCTGGGCCCCCAGGCCCTCCGGGTCCCCCAGGGCCCCCTGGAA
-------------------A--K--G--D--Q--G--P--P--G--P--P--G--P--A--G--P--P--G--P--P--G--P--P--G--P--P--G--

-----------------------------------------------------><---------------------------------------------
S--R--R--A--K--G--P--R--Q--P--S--M--F--N--G--Q--C--P--G--E--T--C--A--I--P--N--D--D--T--L--V--G--K--A
GCAGAAGAGCCAAAGGCCCTCGGCAGCCAAGCATGTTCAACGGCCAGTGCCCAGGTGAGACTTGTGCCATACCAAATGATGATACCTTGGTTGGAAAAGC
:::::::: :::::::::::::::::::::.::::::::::::::::::::::                                 :::.::::::::::
GCAGAAGATCCAAAGGCCCTCGGCAGCCAAACATGTTCAACGGCCAGTGCCCA---------------------------------TTGATTGGAAAAGC
S--R--R--S--K--G--P--R--Q--P--N--M--F--N--G--Q--C--P-----------------------------------L--I--G--K--A

-------------------------------------><-------------------------------------------------------------
--D--E--K--A--S--E--H--H--S--P--Q--A--E--S--M--I--T--S--I--G--N--P--V--Q--V--L--K--V--T--E--T--F--G-
TGATGAGAAAGCCAGTGAACACCATTCCCCACAAGCAGAATCCATGATCACTTCCATTGGAAACCCAGTGCAAGTACTGAAAGTGACAGAGACATTTGGG
.::::::::::.:::.:::::::::::::::::::::   ::: ::::::: :::::::::::.:::...:::::..:.::::: : :::::::::::::
CGATGAGAAAGTCAGCGAACACCATTCCCCACAAGCA---TCCCTGATCACATCCATTGGAAATCCAACACAAGTGTTAAAAGTTAAAGAGACATTTGGG
--D--E--K--V--S--E--H--H--S--P--Q--A-----S--L--I--T--S--I--G--N--P--T--Q--V--L--K--V--K--E--T--F--G-

---------------------------------------------------------------><-----------------------------------
-T--W--I--R--E--S--A--N--K--S--D--D--R--I--W--V--T--E--H--F--S--G--I--M--V--K--E--F--K--D--Q--P--S--
ACTTGGATAAGAGAGTCTGCTAACAAGAGTGATGACCGGATTTGGGTGACAGAGCATTTTTCAGGCATCATGGTTAAGGAATTCAAGGATCAGCCCTCAC
:::::::::::::::::::::::.::::::::.:: :::::.:::::::: ::.::.::::::                                     
ACTTGGATAAGAGAGTCTGCTAATAAGAGTGACGAACGGATCTGGGTGACTGAACACTTTTCA-------------------------------------
-T--W--I--R--E--S--A--N--K--S--D--E--R--I--W--V--T--E--H--F--S--------------------------------------

----------------------------------------------------------------------------------------------------
L--L--N--G--S--Y--T--F--I--H--L--P--Y--Y--F--H--G--C--G--H--V--V--Y--N--N--S--L--Y--Y--H--K--G--G--S
TTCTGAATGGCAGTTACACGTTCATCCACCTTCCATACTATTTCCATGGCTGTGGGCACGTTGTTTACAACAACTCTCTCTACTACCACAAAGGGGGTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
--N--T--L--V--R--F--E--F--G--Q--E--T--S--Q--T--L--K--L--E--N--A--L--Y--F--D--R--K--Y--L--F--A--N--S-
TAATACCCTAGTGAGATTTGAATTTGGCCAGGAAACATCCCAAACTCTGAAGCTTGAAAATGCCTTGTATTTTGATCGAAAATACCTTTTTGCAAATTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--T--Y--F--N--L--A--V--D--E--K--G--L--W--I--I--Y--A--S--S--V--D--G--S--S--I--L--V--A--Q--L--D--E--
AAAACTTACTTCAATCTAGCTGTAGATGAAAAGGGCCTTTGGATTATCTATGCGTCAAGTGTGGACGGCTCGAGCATTCTTGTAGCACAACTGGATGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--T--F--S--V--V--Q--H--V--N--T--T--Y--P--K--S--K--A--G--N--A--F--I--A--R--G--I--L--Y--V--T--D--T--K
GGACATTCTCAGTGGTGCAACACGTCAATACCACGTACCCTAAATCCAAGGCTGGCAACGCCTTCATTGCCCGAGGAATCCTCTATGTCACAGACACCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--M--R--V--T--F--A--F--D--L--L--G--G--K--Q--I--N--A--N--F--D--L--R--T--S--Q--S--V--L--A--M--L--A-
AGATATGAGGGTCACATTTGCCTTTGATTTGTTAGGAGGGAAACAGATCAATGCAAACTTTGATTTAAGAACTTCCCAGTCTGTTCTTGCCATGTTAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------------->
-Y--N--M--R--D--Q--H--L--Y--S--W--E--D--G--H--L--M--L--Y--P--V--Q--F--L--S--T--T--L--N--Q--*-
TACAACATGAGAGATCAGCATTTATATTCATGGGAAGATGGCCATTTAATGCTTTATCCTGTGCAGTTTTTGTCAACTACCTTAAATCAGTGA
                                                                                             
---------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000893721
---------------------------------------------------------------CCTCCAGGAATTGGTGGGTTACCAGGACACAACGGAT
CGGATGGACAGCCTGGTCCCCAGGGCCCAAAAGGCGAAAAAGGAGCAAATGGAAAAAGAGGAAAAATG--------------------------------
----------------------------------------------------------------------------------------------------
------------------GCCAAAGGCGACCAAGGCCCACCTGGCCCACCAGGCCCCGCTGGGCCCCCAGGCCCTCCGGGTCCCCCAGGGCCCCCTGGAA
GCAGAAGATCCAAAGGCCCTCGGCAGCCAAACATGTTCAACGGC---------------------------------TTGATTGGAAAAGCCGATGAGAA
AGTCAGCGAACACCATTCCCCACAAGCA---TCCCTGATCACATCCATTGGAAATCCAACACAAGTGTTAAAAGTTAAAGAGACATTTGGGACTTGGATA
AGAGAGTCTGCTAATAAGAGTGACGAACGGATCTGGGTGACTGAACACTTTTCA----------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------


>BGISUSP0000893721
---------------------PPGIGGLPGHNGSDGQPGPQGPKGEKGANGKRGKM--------------------------------------------
------AKGDQGPPGPPGPAGPPGPPGPPGPPGSRRSKGPRQPNMFNG-----------LIGKADEKVSEHHSPQA-SLITSIGNPTQVLKVKETFGTWI
RESANKSDERIWVTEHFS----------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------