Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000176834 (click for geneview)
Transcript ID ENST00000359236(link to ensembl)
Symbol NP_061959.2
Localtion Chromosome:12:116964124:117004560:-1 band: 12q24.23
Description hypothetical protein FLJ20674
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------------------><--------------------
-M--A--A--G--G--S--A--P--E--P--R--V--L--V--C--L--G--A--L--L--A--G--W--V--A--V--G--L--E--A--V--V--I--
ATGGCCGCAGGCGGCAGTGCGCCCGAGCCCCGCGTCCTCGTCTGCCTCGGGGCGCTCCTGGCCGGCTGGGTCGCCGTAGGATTGGAGGCTGTTGTCATTG
                                                                                 .:::::::::.::::::.:
---------------------------------------------------------------------------------CTGGAGGCTGCTGTCATCG
----------------------------------------------------------------------------------L--E--A--A--V--I--

----------------------------------------------------------------------------------------------------
G--E--V--H--E--N--V--T--L--H--C--G--N--I--S--G--L--R--G--Q--V--T--W--Y--R--N--N--S--E--P--V--F--L--L
GAGAAGTTCATGAGAATGTTACTCTGCACTGTGGCAACATCTCGGGACTGAGGGGCCAGGTGACCTGGTACCGGAACAACTCGGAGCCTGTCTTCCTTCT
:::::::::: ::::::::.:: :::: :::::::::::::::.::::.::::::::  :::::::::::.:::::..:::::::::::::::::::. :
GAGAAGTTCAAGAGAATGTCACGCTGCTCTGTGGCAACATCTCAGGACCGAGGGGCCTCGTGACCTGGTATCGGAATGACTCGGAGCCTGTCTTCCTCGT
G--E--V--Q--E--N--V--T--L--L--C--G--N--I--S--G--P--R--G--L--V--T--W--Y--R--N--D--S--E--P--V--F--L--V

----------------------------------------------------------------------------------------------------
--S--S--N--S--S--L--R--P--A--E--P--R--F--S--L--V--D--A--T--S--L--H--I--E--S--L--S--L--G--D--E--G--I-
CTCGTCCAACTCTAGCCTCCGGCCAGCTGAGCCTCGCTTCTCTCTAGTGGATGCCACCTCCCTGCACATTGAATCGCTGAGCCTGGGAGATGAGGGAATC
 :: :::::.::.::.:: : :.::::. :::: ::::::: :::.:::.:::::: :::::::::::::::. :.::::::::: ..::::::::.: :
GTCCTCCAATTCCAGTCTGCCGTCAGCCCAGCCACGCTTCTGTCTGGTGAATGCCAGCTCCCTGCACATTGAGGCACTGAGCCTGCAGGATGAGGGGAAC
--S--S--N--S--S--L--P--S--A--Q--P--R--F--C--L--V--N--A--S--S--L--H--I--E--A--L--S--L--Q--D--E--G--N-

------------------------------------------------------------><--------------------------------------
-Y--T--C--Q--E--I--L--N--V--T--Q--W--F--Q--V--W--L--Q--V--A--S--G--P--Y--Q--I--E--V--H--I--V--A--T--
TACACCTGCCAGGAGATCCTGAATGTGACTCAGTGGTTCCAAGTGTGGCTGCAGGTGGCCAGCGGCCCCTATCAGATTGAGGTCCACATCGTGGCCACCG
:::::::::..::::.:::::::.: :::::.::::::::::::::::::::::::::::                                        
TACACCTGCTGGGAGGTCCTGAACGAGACTCGGTGGTTCCAAGTGTGGCTGCAGGTGGCC----------------------------------------
-Y--T--C--W--E--V--L--N--E--T--R--W--F--Q--V--W--L--Q--V--A-----------------------------------------

----------------------------------------------------------------------------------------------------
G--T--L--P--N--G--T--L--Y--A--A--R--G--S--Q--V--D--F--S--C--N--S--S--S--R--P--P--P--V--V--E--W--W--F
GCACACTCCCCAACGGCACCCTCTACGCAGCCAGGGGCTCCCAGGTGGACTTCAGCTGCAACAGCAGCTCCAGGCCACCACCCGTGGTTGAATGGTGGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--A--L--N--S--S--S--E--S--F--G--H--N--L--T--V--N--F--F--S--L--L--L--I--S--P--N--L--Q--G--N--Y--T-
CCAGGCCCTGAATTCCAGCAGCGAGTCCTTTGGCCACAACCTGACAGTCAACTTTTTCTCACTGTTACTGATATCGCCAAACCTCCAAGGGAACTACACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
-C--L--A--L--N--Q--L--S--K--R--H--R--K--V--T--T--E--L--L--V--Y--Y--P--P--P--S--A--P--Q--C--W--A--Q--
TGTTTAGCCTTGAATCAGCTCAGCAAGAGACATCGAAAGGTGACCACCGAGCTCCTGGTCTACTATCCCCCTCCATCAGCTCCCCAGTGCTGGGCACAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
M--A--S--G--S--F--M--L--Q--L--T--C--R--W--D--G--G--Y--P--D--P--D--F--L--W--I--E--E--P--G--G--V--I--V
TGGCATCAGGATCGTTCATGTTGCAGCTTACCTGTCGCTGGGATGGGGGATACCCTGACCCTGACTTCCTGTGGATAGAAGAGCCAGGAGGTGTAATCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--K--S--K--L--G--V--E--M--L--S--E--S--Q--L--S--D--G--K--K--F--K--C--V--T--S--H--I--V--G--P--E--S-
GGGGAAGTCAAAGCTGGGGGTGGAAATGCTGAGCGAGTCCCAGCTGTCGGATGGCAAGAAGTTCAAGTGTGTTACAAGCCACATAGTTGGGCCAGAGTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
-G--A--S--C--M--V--Q--I--R--G--P--S--L--L--S--E--P--M--K--T--C--F--T--G--G--N--V--T--L--T--C--Q--V--
GGCGCCAGCTGCATGGTGCAGATCAGGGGTCCCTCCCTTCTCTCTGAGCCCATGAAGACTTGCTTCACTGGGGGCAATGTGACGCTTACATGCCAGGTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--G--A--Y--P--P--A--K--I--L--W--L--R--N--L--T--Q--P--E--V--I--I--Q--P--S--S--R--H--L--I--T--Q--D--G
CTGGGGCCTACCCCCCTGCCAAGATCCTGTGGCTGAGGAACCTTACCCAGCCCGAGGTGATCATCCAGCCTAGCAGCCGCCATCTCATTACCCAGGATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--N--S--T--L--T--I--H--N--C--S--Q--D--L--D--E--G--Y--Y--I--C--R--A--D--S--P--V--G--V--R--E--M--E-
CCAGAACTCCACCCTCACTATCCACAACTGCTCCCAGGACCTGGATGAGGGCTACTACATCTGCCGAGCTGACAGCCCTGTAGGGGTGAGGGAGATGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------><--------------------------------------------------------------------------------
-I--W--L--S--V--K--E--P--L--N--I--G--G--I--V--G--T--I--V--S--L--L--L--L--G--L--A--I--I--S--G--L--L--
ATCTGGCTGAGTGTGAAAGAACCTTTAAATATCGGGGGGATTGTGGGAACCATTGTGAGCCTCCTTCTGCTGGGACTGGCCATTATCTCAGGGCTTCTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><--------------><-----------------------------------------------------
L--H--Y--S--P--V--F--C--W--K--G--K--L--V--S--W--G--Q--N--M--D--D--V--M--V--L--V--D--S--E--E--E--E--E
TGCATTATAGCCCTGTGTTCTGCTGGAAAGGCAAGCTAGTGAGCTGGGGACAAAACATGGATGATGTCATGGTTTTGGTGGATTCAGAAGAGGAAGAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--E--E--E--E--E--E--D--A--A--V--G--E--Q--E--G--A--R--E--R--E--E--L--P--K--E--I--P--K--Q--D--H--I-
GGAGGAGGAGGAGGAGGAGGAAGATGCTGCAGTAGGGGAACAGGAGGGAGCACGTGAGAGAGAGGAGTTGCCAAAAGAAATACCTAAGCAGGACCACATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------><--------------------------------
-H--R--V--T--A--L--V--N--G--N--I--E--Q--M--G--N--G--F--Q--D--L--Q--D--D--S--S--E--E--Q--S--D--I--V--
CACAGAGTGACCGCCTTGGTGAATGGGAACATAGAACAGATGGGAAATGGATTCCAGGATCTTCAAGATGACAGCAGTGAGGAGCAAAGTGACATTGTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------->
Q--E--E--D--R--P--V--*-
AAGAAGAAGACAGGCCAGTCTGA
                       
-----------------------
-----------------------

Pig Consensus Sequence

>BGISUST0000895562
---------------------------------------------------------------------------------CTGGAGGCTGCTGTCATCG
GAGAAGTTCAAGAGAATGTCACGCTGCTCTGTGGCAACATCTCAGGACCGAGGGGCCTCGTGACCTGGTATCGGAATGACTCGGAGCCTGTCTTCCTCGT
GTCCTCCAATTCCAGTCTGCCGTCAGCCCAGCCACGCTTCTGTCTGGTGAATGCCAGCTCCCTGCACATTGAGGCACTGAGCCTGCAGGATGAGGGGAAC
TACACCTGCTGGGAGGTCCTGAACGAGACTCGGTGGTTCCAAGTGTGGCTGCAGGTGGCC----------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------


>BGISUSP0000895562
---------------------------LEAAVIGEVQENVTLLCGNISGPRGLVTWYRNDSEPVFLVSSNSSLPSAQPRFCLVNASSLHIEALSLQDEGN
YTCWEVLNETRWFQVWLQVA--------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------