Sequences
EST Library Info
amn1Amnion
eje3Foetus 50 days, jejunum
jej2Small intestine, jejunum
nje3Newborn 115 days, jejunum
Clusters
Oligos
SNPs

Gene ID ENSG00000104537 (click for geneview)
Transcript ID ENST00000359672(link to ensembl)
Symbol ANXA13
Localtion Chromosome:8:124762216:124797278:-1 band: 8q24.13
Description Annexin A13 (Annexin XIII) (Annexin, intestine-specific) (ISA). [Source:Uniprot/SWISSPROT;Acc:P27216]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------><--------------------------------------------------------------------------><--------
-M--R--G--R--H--A--K--A--S--S--P--Q--G--F--D--V--D--R--D--A--K--K--L--N--K--A--C--K--G--M--G--T--N--
ATGAGGGGCAGGCATGCTAAAGCGAGCAGTCCTCAGGGTTTTGATGTGGATCGAGATGCCAAAAAGCTGAACAAAGCCTGCAAAGGAATGGGGACCAATG
               ::.:::::::. :::  :::::::::.::::: ::::::::::::::::::::: ::::::::::::::::::::   ::..:::
---------------GCCAAAGCGAAAAGTGATCAGGGTTTCGATGTTGATCGAGATGCCAAAAAGCTGCACAAAGCCTGCAAAGGAATG---ACTGATG
----------------A--K--A--K--S--D--Q--G--F--D--V--D--R--D--A--K--K--L--H--K--A--C--K--G--M-----T--D--

-------------------------------------------------------------------------------------><-------------
E--A--A--I--I--E--I--L--S--G--R--T--S--D--E--R--Q--Q--I--K--Q--K--Y--K--A--T--Y--G--K--E--L--E--E--V
AAGCAGCCATCATTGAAATCTTATCGGGCAGGACATCAGATGAGAGGCAACAAATCAAGCAAAAGTACAAGGCAACGTACGGCAAGGAGCTGGAGGAAGT
::::.:::::::::::::::.::::..::::::::::..:::::::::::::::::::.:::::::::::::::::.::.:::::::: ::::::::.::
AAGCGGCCATCATTGAAATCCTATCAAGCAGGACATCGAATGAGAGGCAACAAATCAAACAAAAGTACAAGGCAACATATGGCAAGGACCTGGAGGAGGT
E--A--A--I--I--E--I--L--S--S--R--T--S--N--E--R--Q--Q--I--K--Q--K--Y--K--A--T--Y--G--K--D--L--E--E--V

----------------------------------------------------------------------------------------------------
--L--K--S--E--L--S--G--N--F--E--K--T--A--L--A--L--L--D--R--P--S--E--Y--A--A--R--Q--L--Q--K--A--M--K-
ACTCAAGAGTGAGCTGAGTGGAAACTTCGAGAAGACAGCGTTGGCCCTTCTGGACCGTCCCAGCGAGTACGCCGCCCGGCAGCTGCAGAAGGCTATGAAG
.:::::::::::::::::::::::::::::::::::.:: :::::::::::::::::.::: ::::::::::.::::::::::: :.:::.::.::::::
GCTCAAGAGTGAGCTGAGTGGAAACTTCGAGAAGACGGCCTTGGCCCTTCTGGACCGCCCCTGCGAGTACGCTGCCCGGCAGCTCCGGAAAGCCATGAAG
--L--K--S--E--L--S--G--N--F--E--K--T--A--L--A--L--L--D--R--P--C--E--Y--A--A--R--Q--L--R--K--A--M--K-

--------------------------------------------------------><--------------------------------><--------
-G--L--G--T--D--E--S--V--L--I--E--V--L--C--T--R--T--N--K--E--I--I--A--I--K--E--A--Y--Q--R--L--F--D--
GGTCTGGGCACAGATGAGTCCGTCCTCATTGAGGTCCTGTGCACGAGGACCAATAAGGAAATCATCGCCATTAAAGAGGCCTACCAAAGGCTATTTGATA
::.::::: :::::.:::::::: :::::.:::.:::::::::::::.:::::.:::                                    :::::.:
GGCCTGGGGACAGACGAGTCCGTGCTCATCGAGATCCTGTGCACGAGAACCAACAAG------------------------------------TTTGACA
-G--L--G--T--D--E--S--V--L--I--E--I--L--C--T--R--T--N--K--------------------------------------F--D--

----------------------------------------------------------------------><----------------------------
R--S--L--E--S--D--V--K--G--D--T--S--G--N--L--K--K--I--L--V--S--L--L--Q--A--N--R--N--E--G--D--D--V--D
GGAGCCTCGAATCAGATGTCAAAGGTGATACAAGTGGAAACCTAAAAAAAATCCTGGTGTCTCTGCTGCAGGCTAATCGCAATGAAGGAGATGACGTGGA
:::::::.:::::::::::::::.::::::::::.:::::::::::::::::.::::: ::..::::.:::::::::::..: :::::::::.:::::::
GGAGCCTTGAATCAGATGTCAAAAGTGATACAAGCGGAAACCTAAAAAAAATTCTGGTCTCCTTGCTACAGGCTAATCGTGAAGAAGGAGATAACGTGGA
R--S--L--E--S--D--V--K--S--D--T--S--G--N--L--K--K--I--L--V--S--L--L--Q--A--N--R--E--E--G--D--N--V--D

---------------------------------------><-----------------------------------------------------------
--K--D--L--A--G--Q--D--A--K--D--L--Y--D--A--G--E--G--R--W--G--T--D--E--L--A--F--N--E--V--L--A--K--R-
CAAAGATCTAGCTGGTCAGGATGCCAAAGATCTGTATGATGCAGGGGAAGGCCGCTGGGGCACTGATGAGCTTGCGTTCAATGAAGTCCTGGCCAAGAGG
::::::.:: :: :::::::::::::::::::::::::::::::::::::::::::::::::: ::.:::::::: :::::::::::::::::: :::::
CAAAGACCTCGCAGGTCAGGATGCCAAAGATCTGTATGATGCAGGGGAAGGCCGCTGGGGCACGGACGAGCTTGCCTTCAATGAAGTCCTGGCCCAGAGG
--K--D--L--A--G--Q--D--A--K--D--L--Y--D--A--G--E--G--R--W--G--T--D--E--L--A--F--N--E--V--L--A--Q--R-

-----------------------------------------><---------------------------------------------------------
-S--Y--K--Q--L--R--A--T--F--Q--A--Y--Q--I--L--I--G--K--D--I--E--E--A--I--E--E--E--T--S--G--D--L--Q--
AGCTACAAGCAGTTACGAGCCACCTTTCAAGCCTATCAAATTCTCATTGGCAAAGACATAGAAGAAGCCATTGAAGAAGAAACATCAGGCGACTTGCAGA
::..:::::::::::::::::::::::::::::::.:::                                                             
AGTCACAAGCAGTTACGAGCCACCTTTCAAGCCTACCAA-------------------------------------------------------------
-S--H--K--Q--L--R--A--T--F--Q--A--Y--Q--------------------------------------------------------------

-----------------><---------------------------------------------------------------------------------
K--A--Y--L--T--L--V--R--C--A--Q--D--C--E--D--Y--F--A--E--R--L--Y--K--S--M--K--G--A--G--T--D--E--E--T
AGGCCTATTTAACTCTCGTGAGATGTGCCCAGGATTGTGAGGACTATTTTGCTGAACGTCTGTACAAGTCGATGAAGGGTGCGGGGACCGATGAGGAGAC
                    ::: ::::::.:::.. . :::.:::::::::.:: :::::::::::::: ::::::::.:::::::::::.::::: ::
--------------------AGAAGTGCCCGGGACCTCCAGGGCTATTTTGCCGACCGTCTGTACAAGTCCATGAAGGGCGCGGGGACCGACGAGGACAC
---------------------R--S--A--R--D--L--Q--G--Y--F--A--D--R--L--Y--K--S--M--K--G--A--G--T--D--E--D--T

------------------------------><--------------------------------------------------------------------
--L--I--R--I--V--V--T--R--A--E--V--D--L--Q--G--I--K--A--K--F--Q--E--K--Y--Q--K--S--L--S--D--M--V--R-
GTTGATTCGCATAGTCGTGACCAGGGCCGAGGTGGACCTTCAGGGGATCAAAGCAAAGTTCCAAGAGAAGTATCAGAAGTCTCTCTCTGACATGGTTCGC
:.: ::: .::: .:.:::::::::::.::::::::::::: :: ::: :::::::::::::::::::: ::::::: ::::::::::::::::::::::
GCTCATTGACATCATTGTGACCAGGGCTGAGGTGGACCTTCCGGCGATAAAAGCAAAGTTCCAAGAGAACTATCAGACGTCTCTCTCTGACATGGTTCGC
--L--I--D--I--I--V--T--R--A--E--V--D--L--P--A--I--K--A--K--F--Q--E--N--Y--Q--T--S--L--S--D--M--V--R-

-------------------------------------------------->
-S--D--T--S--G--D--F--R--K--L--L--V--A--L--L--H--*-
TCAGATACCTCCGGGGACTTCCGGAAACTGCTAGTAGCCCTCTTGCACTGA
 ::::.:::::.::::::::::::::::::::.::.:::::::::::::::
GCAGACACCTCTGGGGACTTCCGGAAACTGCTGGTGGCCCTCTTGCACTGA
-A--D--T--S--G--D--F--R--K--L--L--V--A--L--L--H--*-

Pig Consensus Sequence

>BGISUST0000894191
---------------GCCAAAGCGAAAAGTGATCAGGGTTTCGATGTTGATCGAGATGCCAAAAAGCTGCACAAAGCCTGCAAAGGAATG---ACTGATG
AAGCGGCCATCATTGAAATCCTATCAAGCAGGACATCGAATGAGAGGCAACAAATCAAACAAAAGTACAAGGCAACATATGGCAAGGACCTGGAGGAGGT
GCTCAAGAGTGAGCTGAGTGGAAACTTCGAGAAGACGGCCTTGGCCCTTCTGGACCGCCCCTGCGAGTACGCTGCCCGGCAGCTCCGGAAAGCCATGAAG
GGCCTGGGGACAGACGAGTCCGTGCTCATCGAGATCCTGTGCACGAGAACCAACAAG------------------------------------TTTGACA
GGAGCCTTGAATCAGATGTCAAAAGTGATACAAGCGGAAACCTAAAAAAAATTCTGGTCTCCTTGCTACAGGCTAATCGTGAAGAAGGAGATAACGTGGA
CAAAGACCTCGCAGGTCAGGATGCCAAAGATCTGTATGATGCAGGGGAAGGCCGCTGGGGCACGGACGAGCTTGCCTTCAATGAAGTCCTGGCCCAGAGG
AGTCACAAGCAGTTACGAGCCACCTTTCAAGCCTACCAA-------------------------------------------------------------
--------------------AGAAGTGCCCGGGACCTCCAGGGCTATTTTGCCGACCGTCTGTACAAGTCCATGAAGGGCGCGGGGACCGACGAGGACAC
GCTCATTGACATCATTGTGACCAGGGCTGAGGTGGACCTTCCGGCGATAAAAGCAAAGTTCCAAGAGAACTATCAGACGTCTCTCTCTGACATGGTTCGC
GCAGACACCTCTGGGGACTTCCGGAAACTGCTGGTGGCCCTCTTGCACTGA


>BGISUSP0000894191
-----AKAKSDQGFDVDRDAKKLHKACKGM-TDEAAIIEILSSRTSNERQQIKQKYKATYGKDLEEVLKSELSGNFEKTALALLDRPCEYAARQLRKAMK
GLGTDESVLIEILCTRTNK------------FDRSLESDVKSDTSGNLKKILVSLLQANREEGDNVDKDLAGQDAKDLYDAGEGRWGTDELAFNEVLAQR
SHKQLRATFQAYQ---------------------------RSARDLQGYFADRLYKSMKGAGTDEDTLIDIIVTRAEVDLPAIKAKFQENYQTSLSDMVR
ADTSGDFRKLLVALLH*