Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196115 (click for geneview)
Transcript ID ENST00000359790(link to ensembl)
Symbol Q6NVV9_HUMAN
Localtion Chromosome:8:39291267:39394052:1 band: 8p11.23
Description ADAM5 protein.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Q--L--K--N--I--S--Y--G--I--E--P--M--E--A--V--S--G--F--I--H--K--I--Y--E--E--K--Y--A--D--T--N--I--
ATGCAGCTGAAAAACATCTCATATGGAATTGAACCGATGGAGGCTGTATCAGGATTTATACACAAGATTTATGAAGAAAAATATGCTGACACTAATATTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
L--L--E--E--N--D--T--Y--T--W--F--N--S--E--Y--Q--V--R--K--S--S--E--K--T--D--F--I--K--L--F--P--R--Y--I
TCTTAGAAGAAAATGACACTTATACTTGGTTTAATTCAGAGTATCAAGTCAGAAAAAGTTCAGAAAAAACTGACTTTATTAAGTTATTCCCTCGATATAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------><--------------------------------------------------------------------
--E--M--H--I--V--V--D--K--N--L--F--K--P--A--N--M--I--C--R--K--S--V--G--K--E--C--D--F--T--E--Y--C--N-
TGAAATGCATATTGTTGTGGACAAAAATTTGTTCAAACCGGCTAATATGATTTGTAGGAAATCAGTTGGTAAAGAATGCGATTTCACTGAATATTGCAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--D--L--P--Y--C--L--P--D--T--Y--V--R--D--G--E--Y--C--D--S--G--G--A--F--C--F--Q--G--K--C--R--T--F--
GGGGACCTTCCATACTGTTTGCCTGACACTTATGTACGTGATGGAGAATATTGTGATTCAGGTGGAGCCTTCTGTTTTCAAGGAAAGTGTCGGACTTTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------------------------------------------------
D--K--Q--C--D--D--L--I--G--R--G--S--R--G--A--P--V--F--C--Y--D--E--I--N--T--R--G--D--N--F--G--N--C--G
ACAAACAATGTGATGATTTAATTGGAAGAGGTTCAAGAGGTGCTCCGGTTTTCTGTTATGATGAAATTAATACCAGAGGAGACAATTTTGGAAACTGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
--T--A--H--C--L--F--Q--H--I--L--C--G--K--L--V--C--T--W--E--H--R--D--L--I--S--R--P--N--L--S--V--I--Y-
CACTGCACACTGTCTTTTTCAACATATTCTATGTGGAAAATTAGTCTGTACATGGGAACACAGAGACTTAATATCACGTCCAAATTTATCTGTGATTTAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--H--V--R--D--Q--T--C--V--S--T--Y--L--P--R--R--T--P--P--P--V--N--S--P--I--S--I--T--S--Y--Y--S--A--
GCACATGTACGAGACCAAACATGTGTGTCTACATACCTACCCAGGAGGACGCCACCTCCAGTAAATTCACCTATTTCAATCACATCATATTATTCAGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
E--D--R--D--E--T--F--V--Q--D--G--S--M--C--G--P--D--M--Y--C--F--E--M--H--C--K--H--V--R--F--L--M--N--L
AAGACAGAGATGAAACATTTGTACAAGATGGTTCCATGTGTGGTCCTGATATGTATTGTTTCGAAATGCATTGTAAACATGTTAGATTCCTGATGAATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------><-----------------------------------------------------------
--K--L--C--D--A--S--N--H--C--D--R--H--G--V--C--N--N--F--N--H--C--H--C--E--K--G--Y--N--P--P--Y--C--Q-
AAAATTGTGTGATGCTTCTAATCATTGTGATCGTCATGGAGTTTGCAACAATTTTAACCATTGCCATTGTGAAAAGGGATATAATCCTCCTTACTGCCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------><--------------------------->
-P--K--Q--G--A--F--G--S--I--D--D--G--H--L--V--P--P--T--E--R--S--Y--M--E--E--G--R--*-
CCAAAGCAAGGAGCATTTGGAAGTATTGATGATGGACACTTAGTACCACCAACTGAGAGAAGTTACATGGAGGAGGGAAGATAG
                                                                                    
------------------------------------------------------------------------------------
------------------------------------------------------------------------------------