Sequences
EST Library Info
cly1Lymph - RNA from China
ecc1Foetus 50 days, cortex cerebri
nco3Newborn 115 days, colon
Clusters
Oligos
SNPs

Gene ID ENSG00000188603 (click for geneview)
Transcript ID ENST00000360019(link to ensembl)
Symbol CLN3
Localtion Chromosome:16:28396102:28413398:-1 band: 16p11.2
Description CLN3 protein (Battenin) (Batten disease protein). [Source:Uniprot/SWISSPROT;Acc:Q13286]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------><-----------------------------------------------------
-M--G--G--C--A--G--S--R--R--R--F--S--D--S--E--G--E--E--T--V--P--E--P--R--L--P--L--L--D--H--Q--G--A--
ATGGGAGGCTGTGCAGGCTCGCGGCGGCGCTTTTCGGATTCCGAGGGGGAGGAGACCGTCCCGGAGCCCCGGCTCCCTCTGTTGGACCATCAGGGCGCGC
                                                :::::::::: ::::: .::.::: ..::::::. :::::.::::::::: :
------------------------------------------------GAGGAGACCGACCCGGCACCTCGGGCTCCTCTGCAGGACCGTCAGGGCGCCC
-------------------------------------------------E--E--T--D--P--A--P--R--A--P--L--Q--D--R--Q--G--A--

------------------------><--------------------------------------------------------------------------
H--W--K--N--A--V--G--F--W--L--L--G--L--C--N--N--F--S--Y--V--V--M--L--S--A--A--H--D--I--L--S--H--K--R
ATTGGAAGAACGCGGTGGGCTTCTGGCTGCTGGGCCTTTGCAACAACTTCTCTTATGTGGTGATGCTGAGTGCCGCCCACGACATCCTTAGCCACAAGAG
:::::::::::::::::::::::   :: ::::::::.::::::::::::::::::::::::::::: :::::.:::::::::::::::::.::: ::::
ATTGGAAGAACGCGGTGGGCTTC---CTCCTGGGCCTCTGCAACAACTTCTCTTATGTGGTGATGCTCAGTGCTGCCCACGACATCCTTAGTCACCAGAG
H--W--K--N--A--V--G--F-----L--L--G--L--C--N--N--F--S--Y--V--V--M--L--S--A--A--H--D--I--L--S--H--Q--R

---------------------><----------------------------------------------------------------------><-----
--T--S--G--N--Q--S--H--V--D--P--G--P--T--P--I--P--H--N--S--S--S--R--F--D--C--N--S--V--S--T--A--A--V-
GACATCGGGAAACCAGAGCCATGTGGACCCAGGCCCAACGCCGATCCCCCACAACAGCTCATCACGATTTGACTGCAACTCTGTCTCTACGGCTGCTGTG
..::.: ::.:::::::::                                                                                 
AGCACCTGGGAACCAGAGC---------------------------------------------------------------------------------
--A--P--G--N--Q--S----------------------------------------------------------------------------------

-------------------------------------------------------------------------><-------------------------
-L--L--A--D--I--L--P--T--L--V--I--K--L--L--A--P--L--G--L--H--L--L--P--Y--S--P--R--V--L--V--S--G--I--
CTCCTGGCGGACATCCTCCCCACACTCGTCATCAAATTGTTGGCTCCTCTTGGCCTTCACCTGCTGCCCTACAGCCCCCGGGTTCTCGTCAGTGGGATTT
                                                                           ::::::::::::..:::::::::.:
---------------------------------------------------------------------------CCCCGGGTTCTCACCAGTGGGATCT
----------------------------------------------------------------------------P--R--V--L--T--S--G--I--

-----------------------------------------------------------><---------------------------------------
C--A--A--G--S--F--V--L--V--A--F--S--H--S--V--G--T--S--L--C--G--V--V--F--A--S--I--S--S--G--L--G--E--V
GTGCTGCTGGAAGCTTCGTCCTGGTTGCCTTTTCTCATTCTGTGGGGACCAGCCTGTGTGGTGTGGTCTTCGCTAGCATCTCATCAGGCCTTGGGGAGGT
::::.::::::::::::.::.::::.:::::.:::::::: :::: .::::::::::::   :::::::: ::::::::::: :::::.:: ::::::::
GTGCCGCTGGAAGCTTCATCTTGGTCGCCTTCTCTCATTCGGTGGCAACCAGCCTGTGT---GTGGTCTTGGCTAGCATCTCTTCAGGTCTGGGGGAGGT
C--A--A--G--S--F--I--L--V--A--F--S--H--S--V--A--T--S--L--C-----V--V--L--A--S--I--S--S--G--L--G--E--V

--------------------------------><------------------------------------------------------------------
--T--F--L--S--L--T--A--F--Y--P--R--A--V--I--S--W--W--S--S--G--T--G--G--A--G--L--L--G--A--L--S--Y--L-
CACCTTCCTCTCCCTCACTGCCTTCTACCCCAGGGCCGTGATCTCCTGGTGGTCCTCAGGGACTGGGGGAGCTGGGCTGCTGGGGGCCCTGTCCTACCTG
::::::::::::::::::. :::::::::::   .::::::::::::::::::::::.:: :::::::::::.:::::.:::::::: .:::::::::::
CACCTTCCTCTCCCTCACCTCCTTCTACCCC---ACCGTGATCTCCTGGTGGTCCTCGGGTACTGGGGGAGCCGGGCTACTGGGGGCATTGTCCTACCTG
--T--F--L--S--L--T--S--F--Y--P-----T--V--I--S--W--W--S--S--G--T--G--G--A--G--L--L--G--A--L--S--Y--L-

----------------------------------------------------------------------------><----------------------
-G--L--T--Q--A--G--L--S--P--Q--Q--T--L--L--S--M--L--G--I--P--A--L--L--L--A--S--Y--F--L--L--L--T--S--
GGCCTCACCCAGGCCGGCCTCTCCCCTCAGCAGACCCTGCTGTCCATGCTGGGTATCCCTGCCCTGCTGCTGGCCAGCTATTTCTTGTTGCTCACATCTC
::::::::::::::::::::::::::.::::: :::.::::::::::::::::::::::.:::::: ::::.:::   ::::::.::::::::::.::::
GGCCTCACCCAGGCCGGCCTCTCCCCCCAGCACACCTTGCTGTCCATGCTGGGTATCCCCGCCCTGATGCTAGCC---TATTTCCTGTTGCTCACGTCTC
-G--L--T--Q--A--G--L--S--P--Q--H--T--L--L--S--M--L--G--I--P--A--L--M--L--A-----Y--F--L--L--L--T--S--

-----------------------------------------------------------------------------------------><---------
P--E--A--Q--D--P--G--G--E--E--E--A--E--S--A--A--R--Q--P--L--I--R--T--E--A--P--E--S--K--P--G--S--S--S
CTGAGGCCCAGGACCCTGGAGGGGAAGAAGAAGCAGAGAGCGCAGCCCGGCAGCCCCTCATAAGAACCGAGGCCCCGGAGTCGAAGCCAGGCTCCAGCTC
:::.: ::::::::::::::::::::::.::.:::::::  ::::::::::::::::: ::::. : ::::::::: ::::.:::::::           
CTGGGTCCCAGGACCCTGGAGGGGAAGAGGAGGCAGAGACAGCAGCCCGGCAGCCCCTGATAAATAGCGAGGCCCCCGAGTTGAAGCCA-----------
P--G--S--Q--D--P--G--G--E--E--E--A--E--T--A--A--R--Q--P--L--I--N--S--E--A--P--E--L--K--P------------

------------------------------------><--------------------------------------------------------------
--S--L--S--L--R--E--R--W--T--V--F--K--G--L--L--W--Y--I--V--P--L--V--V--V--Y--F--A--E--Y--F--I--N--Q-
CAGCCTCTCCCTTCGGGAAAGGTGGACAGTGTTCAAGGGTCTGCTGTGGTACATTGTTCCCTTGGTCGTAGTTTACTTTGCCGAGTATTTCATTAACCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----><------------------------------------------------------><-------------------------------------
-G--L--F--E--L--L--F--F--W--N--T--S--L--S--H--A--Q--Q--Y--R--W--Y--Q--M--L--Y--Q--A--G--V--F--A--S--
GGACTTTTTGAACTCCTCTTTTTCTGGAACACTTCCCTGAGTCACGCTCAGCAATACCGCTGGTACCAGATGCTGTACCAGGCTGGCGTCTTTGCCTCCC
                                                               :::::::::::.:::::::::::::::::::::::::
---------------------------------------------------------------TACCAGATGCTATACCAGGCTGGCGTCTTTGCCTCCC
----------------------------------------------------------------Y--Q--M--L--Y--Q--A--G--V--F--A--S--

-------------------------------------------------------><-------------------------------------------
R--S--S--L--R--C--C--R--I--R--F--T--W--A--L--A--L--L--Q--C--L--N--L--V--F--L--L--A--D--V--W--F--G--F
GCTCTTCTCTCCGCTGCTGTCGCATCCGTTTCACCTGGGCCCTGGCCCTGCTGCAGTGCCTCAACCTGGTGTTCCTGCTGGCAGACGTGTGGTTCGGCTT
::::.::::::::::::::::.::::::.. ::: ::::::::::::.::::.::::::::::::::::. :::::::::::.:::::::::.: .::::
GCTCCTCTCTCCGCTGCTGTCACATCCGCCACACGTGGGCCCTGGCCTTGCTACAGTGCCTCAACCTGGCCTTCCTGCTGGCGGACGTGTGGCTGAGCTT
R--S--S--L--R--C--C--H--I--R--H--T--W--A--L--A--L--L--Q--C--L--N--L--A--F--L--L--A--D--V--W--L--S--F

------------------------------------------------------------------------------------------------><--
--L--P--S--I--Y--L--V--F--L--I--I--L--Y--E--G--L--L--G--G--A--A--Y--V--N--T--F--H--N--I--A--L--E--T-
TCTGCCAAGCATCTACCTCGTCTTCCTGATCATTCTGTATGAGGGGCTCCTGGGAGGCGCAGCCTACGTGAACACCTTCCACAACATCGCCCTGGAGACC
.::::: :::::::::::::::::::::::::::::::::::::::::::::::::: ::.:::::::::::::::::.:::::.::.::::::::::::
CCTGCCCAGCATCTACCTCGTCTTCCTGATCATTCTGTATGAGGGGCTCCTGGGAGGAGCGGCCTACGTGAACACCTTTCACAATATTGCCCTGGAGACC
--L--P--S--I--Y--L--V--F--L--I--I--L--Y--E--G--L--L--G--G--A--A--Y--V--N--T--F--H--N--I--A--L--E--T-

----------------------------------------------------------------------------------------------------
-S--D--E--H--R--E--F--A--M--A--A--T--C--I--S--D--T--L--G--I--S--L--S--G--L--L--A--L--P--L--H--D--F--
AGTGATGAGCACCGGGAGTTTGCAATGGCGGCCACCTGCATCTCTGACACACTGGGGATCTCCCTGTCGGGGCTCCTGGCTTTGCCTCTGCATGACTTCC
:::::::::::.:::::.::::: :::::..::.::::.:::::.::::: .:::::::::: :: ::.:::::::::::..::::::::::.:::::::
AGTGATGAGCATCGGGAATTTGCCATGGCAACCGCCTGTATCTCCGACACCTTGGGGATCTCGCTCTCAGGGCTCCTGGCCCTGCCTCTGCACGACTTCC
-S--D--E--H--R--E--F--A--M--A--T--A--C--I--S--D--T--L--G--I--S--L--S--G--L--L--A--L--P--L--H--D--F--

---------------->
L--C--Q--L--S--*-
TCTGCCAGCTCTCCTGA
::::::. :::::::::
TCTGCCGCCTCTCCTGA
L--C--R--L--S--*-

Pig Consensus Sequence

>BGISUST0000878554
------------------------------------------------GAGGAGACCGACCCGGCACCTCGGGCTCCTCTGCAGGACCGTCAGGGCGCCC
ATTGGAAGAACGCGGTGGGCTTC---CTCCTGGGCCTCTGCAACAACTTCTCTTATGTGGTGATGCTCAGTGCTGCCCACGACATCCTTAGTCACCAGAG
AGCACCTGGGAACCAGAGC---------------------------------------------------------------------------------
---------------------------------------------------------------------------CCCCGGGTTCTCACCAGTGGGATCT
GTGCCGCTGGAAGCTTCATCTTGGTCGCCTTCTCTCATTCGGTGGCAACCAGCCTGTGT---GTGGTCTTGGCTAGCATCTCTTCAGGTCTGGGGGAGGT
CACCTTCCTCTCCCTCACCTCCTTCTACCCC---ACCGTGATCTCCTGGTGGTCCTCGGGTACTGGGGGAGCCGGGCTACTGGGGGCATTGTCCTACCTG
GGCCTCACCCAGGCCGGCCTCTCCCCCCAGCACACCTTGCTGTCCATGCTGGGTATCCCCGCCCTGATGCTAGCC---TATTTCCTGTTGCTCACGTCTC
CTGGGTCCCAGGACCCTGGAGGGGAAGAGGAGGCAGAGACAGCAGCCCGGCAGCCCCTGATAAATAGCGAGGCCCCCGAGTTGAAGCCA-----------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------TACCAGATGCTATACCAGGCTGGCGTCTTTGCCTCCC
GCTCCTCTCTCCGCTGCTGTCACATCCGCCACACGTGGGCCCTGGCCTTGCTACAGTGCCTCAACCTGGCCTTCCTGCTGGCGGACGTGTGGCTGAGCTT
CCTGCCCAGCATCTACCTCGTCTTCCTGATCATTCTGTATGAGGGGCTCCTGGGAGGAGCGGCCTACGTGAACACCTTTCACAATATTGCCCTGGAGACC
AGTGATGAGCATCGGGAATTTGCCATGGCAACCGCCTGTATCTCCGACACCTTGGGGATCTCGCTCTCAGGGCTCCTGGCCCTGCCTCTGCACGACTTCC
TCTGCCGCCTCTCCTGA


>BGISUSP0000878554
----------------EETDPAPRAPLQDRQGAHWKNAVGF-LLGLCNNFSYVVMLSAAHDILSHQRAPGNQS---------------------------
-------------------------PRVLTSGICAAGSFILVAFSHSVATSLC-VVLASISSGLGEVTFLSLTSFYP-TVISWWSSGTGGAGLLGALSYL
GLTQAGLSPQHTLLSMLGIPALMLA-YFLLLTSPGSQDPGGEEEAETAARQPLINSEAPELKP-------------------------------------
---------------------YQMLYQAGVFASRSSLRCCHIRHTWALALLQCLNLAFLLADVWLSFLPSIYLVFLIILYEGLLGGAAYVNTFHNIALET
SDEHREFAMATACISDTLGISLSGLLALPLHDFLCRLS*