Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197605 (click for geneview)
Transcript ID ENST00000360199(link to ensembl)
Localtion Chromosome:16:32297917:32298822:-1 band: 16p11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------><------------------------------------------
-E--D--H--Y--F--L--M--T--E--L--P--L--N--T--L--E--N--T--E--F--A--E--I--M--F--E--L--F--N--V--P--G--F--
GAGGACCATTATTTTTTAATGACAGAACTTCCACTGAATACACTAGAAAATACAGAGTTTGCAGAAATTATGTTTGAACTATTTAATGTACCAGGATTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--I--A--V--Q--D--V--L--A--L--E--V--S--W--T--S--Q--Q--V--G--E--Y--M--L--M--S--T--V--I--D--K--G--D--G
ACATTGCAGTTCAGGATGTACTAGCCTTGGAAGTATCTTGGACATCTCAACAAGTGGGTGAATATATGTTAATGAGTACAGTCATTGACAAAGGAGATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--T--L--V--L--P--V--V--E--G--Y--V--I--E--S--C--I--N--H--I--L--I--V--G--D--T--V--Y--F--I--Q--Q--L-
AGTCACCCTTGTTCTCCCAGTTGTAGAAGGTTATGTAATTGAGAGCTGCATCAATCACATCCTGATTGTAGGTGATACTGTGTATTTCATTCAACAACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--R--E--R--E--V--G--I--P--L--E--Q--S--L--E--T--T--K--A--I--K--E--K--Y--C--Y--F--C--P--D--I--V--K--
CTAAGGGAGAGGGAGGTAGGAATCCCTCTTGAGCAGTCACTGGAGACCACAAAAGCCATTAAGGAGAAATACTGTTACTTTTGCCCTGATATAGTCAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--F--A--K--Y--D--V--D--P--W--K--W--I--K--Q--Y--T--G--I--N--V--I--N--Q--E--K--F--I--I--D--V--G--Y--K
AATTTGCTAAGTATGATGTGGATCCCTGGAAGTGGATCAAACAGTACACAGGTATCAATGTGATCAACCAGGAGAAGTTCATAATAGACGTTGGTTACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
--R--L--L--Q--P--E--I--F--F--Y--P--E--F--A--N--P--D--F--M--E--S--I--L--N--I--V--D--I--Q--N--C--P--I-
AAGGCTCCTGCAACCTGAAATATTTTTTTACCCAGAGTTTGCCAACCCAGACTTTATGGAATCCATCTTGAATATTGTTGATATACAAAACTGTCCCATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
-D--V--H--C--P--L--Y--K--N--V--V--L--S--R--G--L--A--I--F--G--Y--E--S--Q--L--Q--R--D--L--K--S--G--T--
GATGTGCATTGTCCACTGTATAAGAATGTTGTTCTTTCAAGGGGTTTGGCCATATTCGGATATGAATCTCAACTACAGAGAGATTTGAAGAGTGGTACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><-----------------------------------------------------------------------------------
C--Q--I--K--T--Q--I--I--K--P--K--L--T--E--V--R--V--V--I--R--H--M--Q--H--Y--A--L--W--F--G--S--L--M--L
GCCAGATTAAAACTCAGATAATCAAACCTAAGCTTACAGAGGTCCGGGTGGTAATCCGTCACATGCAGCACTATGCCTTATGGTTTGGAAGCTTAATGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------>
--A--S--T--L--E--L--F--Q--V--C--H--T--K--K--D--Y--K--E--Y--G--P--S--I--C--H--Q-
AGCCTCAACTCTGGAGTTATTTCAGGTCTGTCACACCAAGAAGGACTATAAAGAATATGGCCCCAGCATCTGCCACCAG
                                                                               
-------------------------------------------------------------------------------
-------------------------------------------------------------------------------