Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000197416 (click for geneview)
Transcript ID ENST00000360464(link to ensembl)
Localtion Chromosome:8:82599863:82606105:-1 band: 8q21.13
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------------><--------------------------
-M--I--D--Q--L--Q--G--T--W--K--S--I--S--C--E--N--S--E--D--Y--M--K--E--L--G--I--G--R--A--S--R--K--L--
ATGATTGACCAGCTCCAAGGAACATGGAAGTCCATTTCTTGTGAAAATTCCGAAGACTACATGAAGGAGCTGGGTATAGGAAGAGCCAGCAGGAAACTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--R--L--A--K--P--T--V--T--I--S--T--D--G--D--V--I--T--I--K--T--K--S--I--F--K--N--N--E--I--S--F--K--L
GCCGTTTGGCAAAACCCACTGTGACCATCAGTACAGATGGAGATGTCATCACAATAAAAACCAAAAGCATCTTTAAAAATAATGAGATCTCCTTTAAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------><-----------------------------------------------------
--G--E--E--F--E--E--I--T--P--G--G--H--K--T--K--S--K--V--T--L--D--K--E--S--L--I--Q--V--Q--D--W--D--G-
GGGAGAAGAGTTTGAGGAAATCACGCCAGGTGGCCACAAAACAAAGAGTAAAGTAACCTTAGATAAGGAGTCCCTGATTCAAGTTCAGGACTGGGATGGC
                                                                   :: :::.::::::::::::::::.:::: ::::
-------------------------------------------------------------------GACTCCTTGATTCAAGTTCAGGATTGGGCTGGC
--------------------------------------------------------------------D--S--L--I--Q--V--Q--D--W--A--G-

-----------------------------------------------><---------------------------------------------->
-K--E--T--T--I--T--R--K--L--V--D--G--K--M--V--V--E--S--T--V--N--S--V--I--C--T--R--T--Y--E--K--V-
AAAGAAACCACCATAACGAGAAAGCTGGTGGATGGGAAAATGGTGGTGGAAAGTACTGTGAACAGTGTTATCTGTACACGAACATACGAGAAAGTA
:..::.::. :::::: :::::::.::::.::::::::::::.::                                                   
AGGGAGACTCCCATAAGGAGAAAGTTGGTAGATGGGAAAATGATG---------------------------------------------------
-R--E--T--P--I--R--R--K--L--V--D--G--K--M--M----------------------------------------------------

Pig Consensus Sequence

>BGISUST0000889802
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------------GACTCCTTGATTCAAGTTCAGGATTGGGCTGGC
AGGGAGACTCCCATAAGGAGAAAGTTGGTAGATGGGAAAATGATG---------------------------------------------------


>BGISUSP0000889802
-----------------------------------------------------------------------------------------DSLIQVQDWAG
RETPIRRKLVDGKMM-----------------