Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000161010 (click for geneview)
Transcript ID ENST00000360718(link to ensembl)
Symbol Q7Z3D8_HUMAN
Localtion Chromosome:5:179196784:179218466:-1 band: 5q35.3
Description Hypothetical protein DKFZp686L2452 (Fragment).
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-G--A--A--A--G--Q--M--Q--S--A--R--A--W--L--P--G--D--C--T--S--R--D--G--V--A--S--A--F--S--G--A--T--L--
GGGGCCGCGGCGGGACAAATGCAGAGCGCACGCGCTTGGCTGCCTGGCGACTGCACAAGCAGGGATGGCGTCGCTTCAGCGTTCTCGGGTGCTACGCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><----------------------------------------------------------><---------
L--Q--L--P--P--L--P--G--A--P--G--K--K--E--C--Q--V--D--M--Q--S--L--W--R--E--A--V--L--F--A--E--F--P--R
TGCAGCTGCCGCCTCTTCCAGGCGCACCAGGTAAAAAAGAGTGTCAAGTGGACATGCAAAGCTTGTGGAGAGAAGCAGTCCTTTTTGCAGAGTTCCCCAG
                                :::::::::: ::::.:::::::::::::::::::::::::::::::: :::::              
--------------------------------AAAAAAGAGTCTCAAATGGACATGCAAAGCTTGTGGAGAGAAGCAGTCGTTTTT--------------
---------------------------------K--K--E--S--Q--M--D--M--Q--S--L--W--R--E--A--V--V--F---------------

---------------------------------------------------------------------><-----------------------------
--H--G--A--P--A--S--E--L--P--V--P--S--G--S--E--M--D--G--A--E--S--G--K--A--Y--G--E--G--S--G--A--D--C-
ACACGGAGCTCCTGCTTCCGAGCTTCCTGTTCCTTCAGGAAGTGAAATGGATGGAGCAGAATCTGGAAAGGCTTATGGTGAAGGCTCTGGTGCTGATTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
-R--R--H--V--Q--K--L--N--L--L--Q--G--Q--V--S--E--L--P--L--R--S--L--E--E--T--V--S--A--S--E--E--E--N--
AGACGCCATGTCCAAAAGTTAAATCTACTACAGGGACAAGTTTCAGAGCTGCCACTCAGGTCTCTAGAAGAAACTGTCAGTGCCAGTGAAGAAGAAAACG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------><----------------------------------------------------------------
V--G--H--Q--Q--A--G--N--V--K--Q--Q--E--K--S--Q--P--S--E--S--R--W--L--K--Y--L--E--K--D--S--Q--E--L--E
TGGGACACCAGCAGGCTGGGAATGTGAAGCAGCAGGAAAAATCGCAGCCCTCAGAGAGTCGCTGGCTGAAGTATCTAGAAAAGGACTCCCAAGAACTGGA
                                   ::::::.: ::::::::::::::.:::::::::::::::::.::::. :::::: :::: ::::.
-----------------------------------GAAAAACCCCAGCCCTCAGAGAGCCGCTGGCTGAAGTATCTGGAAAGTGACTCCAAAGACCTGGG
------------------------------------E--K--P--Q--P--S--E--S--R--W--L--K--Y--L--E--S--D--S--K--D--L--G

--------------------------------------------------------------------------------------------><------
--L--E--G--T--G--V--C--F--S--K--Q--P--S--S--K--M--E--E--P--G--P--R--F--S--Q--D--L--P--R--K--R--K--W-
GCTGGAAGGAACAGGAGTGTGTTTCAGCAAACAGCCTTCATCCAAAATGGAGGAGCCAGGCCCCCGCTTCAGTCAAGACCTGCCTAGAAAAAGGAAGTGG
::::                                                                                                
GCTG------------------------------------------------------------------------------------------------
--L-------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------><------------------
-S--R--S--T--V--Q--P--P--C--S--R--G--V--Q--D--S--G--G--S--E--V--A--W--G--P--Q--K--G--Q--A--G--L--T--
AGCAGGAGCACCGTCCAGCCTCCGTGCAGCCGTGGCGTGCAGGACTCGGGTGGCTCTGAGGTCGCCTGGGGACCCCAGAAGGGACAGGCTGGCCTGACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
W--K--V--K--Q--G--S--S--P--C--L--Q--E--N--S--A--D--C--S--A--G--E--L--R--G--P--G--K--E--L--W--S--P--I
GGAAGGTGAAACAAGGCAGCAGCCCCTGCCTCCAGGAGAACTCTGCAGACTGCAGTGCCGGGGAGCTGAGGGGTCCTGGGAAGGAGCTATGGAGTCCCAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------><------------------------->
--Q--Q--D--G--Y--K--E--I--L--F--*-
CCAGCAGGATGGCTACAAAGAGATCTTATTTTAA
                                  
----------------------------------
----------------------------------

Pig Consensus Sequence

>BGISUST0000892587
----------------------------------------------------------------------------------------------------
--------------------------------AAAAAAGAGTCTCAAATGGACATGCAAAGCTTGTGGAGAGAAGCAGTCGTTTTT--------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------GAAAAACCCCAGCCCTCAGAGAGCCGCTGGCTGAAGTATCTGGAAAGTGACTCCAAAGACCTGGG
GCTG------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------


>BGISUSP0000892587
--------------------------------------------KKESQMDMQSLWREAVVF--------------------------------------
---------------------------------------------EKPQPSESRWLKYLESDSKDLGL--------------------------------
------------------------------------------------------------------------------