Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198215 (click for geneview)
Transcript ID ENST00000361061(link to ensembl)
Symbol Q8N962_HUMAN
Localtion Chromosome:1:15181789:15182464:1 band: 1p36.21
Description Hypothetical protein FLJ38312.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--W--V--Y--V--C--C--V--C--M--C--R--W--C--L--C--M--C--V--Y--I--Y--V--R--V--C--A--C--V--C--M--C--V--
ATGTGGGTATATGTGTGTTGTGTATGTATGTGTAGATGGTGTTTGTGTATGTGTGTATATATATATGTGCGTGTGTGTGCCTGTGTGTGTATGTGTGTAT
                                          .: :::::::::::::::::::::.::. ::::::::. :::::.          : :
------------------------------------------CTCTGTATGTGTGTATATATATATATGTTTGTGTGTGTGTGTGTA---------TTTT
-------------------------------------------L--C--M--C--V--Y--I--Y--M--F--V--C--V--C--V-----------F--

-----------------------------><---------------------------------------------------------------------
Y--V--C--V--Y--V--R--I--C--V--L--C--I--C--V--F--V--C--V--C--V--F--V--C--A--H--M--C--S--C--V--F--V--Y
ATGTATGTGTGTATGTGCGTATTTGTGTGTTGTGTATTTGTGTGTTTGTGTGTGTCTGTGTATTTGTGTGTGCGCATATGTGTTCATGTGTATTTGTGTA
::.:::::.:.:::                                                                                      
ATATATGTATATAT--------------------------------------------------------------------------------------
Y--I--C--I--Y---------------------------------------------------------------------------------------

------------------------------------------------------------><--------------------------------------
--V--C--I--C--V--C--L--Y--V--C--V--F--V--C--V--C--M--C--V--Y--C--V--F--V--C--M--C--L--C--V--C--I--C-
TGTGTGTATTTGTGTGTGTTTGTATGTTTGTGTATTTGTGTGTGTATGTATGTGTGTGTATTGTGTGTTTGTGTGTATGTGTTTGTGTGTGTGCATATGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
-V--C--V--C--V--C--V--S--S--H--L--V--L--T--M--T--C--R--G--S--S--V--I--N--P--T--L--L--S--T--R--P--R--
GTTTGTGTGTGTGTGTGTGTGTCCTCTCATTTAGTCCTCACAATGACCTGCCGAGGAAGTTCTGTTATTAACCCCACTCTGCTCAGCACGCGGCCCAGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------->
P--C--Q--R--*-
CATGCCAACGCTAA
              
--------------
--------------

Pig Consensus Sequence

>BGISUST0000880191
------------------------------------------CTCTGTATGTGTGTATATATATATATGTTTGTGTGTGTGTGTGTATTTTATATATGTA
TATAT-----------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----


>BGISUSP0000880191
--------------LCMCVYIYMFVCVCVFYICIY-----------------------------------------------------------------
-----------------------------------