Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198902 (click for geneview)
Transcript ID ENST00000361504(link to ensembl)
Localtion Chromosome:1:91202199:91202387:1 band: 1p22.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--E--M--C--K--K--A--H--A--A--I--R--E--S--P--V--C--E--K--K--P--K--K--E--V--K--K--K--K--W--N--R--
ATGGAAGAGATGTGTAAGAAAGCTCATGCTGCTATACGAGAGAGTCCAGTCTGTGAAAAGAAGCCCAAGAAAGAAGTTAAAAAGAAGAAGTGGAACCGAC
                                                                        :::::: :::::::::.::::.::.: .
------------------------------------------------------------------------GAAGTTCAAAAGAAGAGGTGGGACTGTT
-------------------------------------------------------------------------E--V--Q--K--K--R--W--D--C--

---------------------------------------------------------------------------------------->
P--K--M--S--L--A--Q--K--K--D--W--V--A--Q--K--K--A--S--F--L--R--A--Q--E--R--A--A--E--S--*-
CCAAAATGTCCCTTGCTCAGAAGAAAGATTGGGTAGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAA
:::.::::::.::::::::::::::.::::::::::::::.::::::::::::::::::::::::::::::. :.:.. ::::      
CCAGAATGTCTCTTGCTCAGAAGAAGGATTGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGTTGACCAGTGAG------
S--R--M--S--L--A--Q--K--K--D--W--V--A--Q--K--K--A--S--F--L--R--A--Q--E--L--T--S--E-------

Pig Consensus Sequence

>BGISUST0000877347
------------------------------------------------------------------------GAAGTTCAAAAGAAGAGGTGGGACTGTT
CCAGAATGTCTCTTGCTCAGAAGAAGGATTGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGTTGACCAGTGAG------


>BGISUSP0000877347
------------------------EVQKKRWDCSRMSLAQKKDWVAQKKASFLRAQELTSE--