Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198702 (click for geneview)
Transcript ID ENST00000361614(link to ensembl)
Symbol Q8NBL2_HUMAN
Localtion Chromosome:2:81721481:81723378:1 band: 2p12
Description Hypothetical protein PSEC0134.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--M--Y--M--T--S--A--Y--S--N--M--L--T--D--Y--T--P--V--I--L--M--A--V--A--A--A--V--V--A--A--A--I--T--
ATGATGTATATGACCTCAGCTTATTCTAATATGCTTACAGATTATACACCCGTGATATTGATGGCAGTGGCTGCTGCTGTCGTGGCTGCTGCTATCACGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--A--A--T--Q--R--C--D--W--G--C--T--F--H--G--G--V--G--S--S--A--P--S--D--V--G--K--E--I--P--R--C--P--C
CTGCTGCAACACAGAGGTGCGACTGGGGCTGCACATTTCACGGAGGTGTTGGGAGTTCCGCCCCTTCTGATGTGGGGAAAGAGATCCCCAGGTGCCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--I--C--P--N--C--G--C--G--S--E--A--P--G--W--Q--V--G--S--F--R--V--Q--L--R--P--P--S--Q--V--Q--D--P--G-
CATCTGCCCAAACTGTGGCTGTGGATCGGAGGCTCCAGGTTGGCAGGTTGGGAGCTTCCGGGTGCAGCTGCGACCGCCCTCCCAGGTGCAGGACCCTGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--S--A--A--C--T--L--G--G--P--R--K--D--P--Y--P--C--R--L--G--G--V--C--F--F--C--L--A--S--L--G--S--R--
GTTTCTGCAGCCTGCACCCTTGGGGGCCCCAGGAAAGACCCATATCCTTGCAGGCTTGGAGGTGTTTGCTTCTTCTGCCTGGCCTCTCTCGGCTCCCGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------->
C--M--L--S--Y--L--S--G--G--W--C--*-
GCATGCTCTCATATCTGAGTGGGGGTTGGTGCTGA
                                   
-----------------------------------
-----------------------------------