Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198861 (click for geneview)
Transcript ID ENST00000361674(link to ensembl)
Symbol ENK13_HUMAN
Localtion Chromosome:1:109959895:109964215:1 band: 1p13.3
Description Hypothetical HERV-K_1p13.3 provirus ancestral Env polyprotein (Envelope polyprotein) [Includes: Truncated surface protein (SU)].
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--P--G--A--I--D--D--H--C--P--A--Q--P--G--E--E--G--T--A--F--N--V--T--M--G--Y--K--Y--P--P--L--C--L--
ATGCCTGGAGCTATAGATGACCATTGCCCTGCTCAACCAGGAGAAGAAGGCACTGCATTTAATGTTACTATGGGTTATAAATACCCTCCTCTGTGCCTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--H--A--T--R--C--I--H--L--E--T--Q--V--W--A--A--Y--L--L--E--R--L--A--T--G--K--W--G--H--L--V--S--G--L
GACATGCAACTCGTTGTATCCATCTAGAAACTCAAGTCTGGGCTGCTTATCTTCTGGAGAGATTAGCTACAGGAAAATGGGGACATTTGGTCTCCGGCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--L--C--P--L--R--Q--M--K--R--G--V--I--G--D--T--P--Y--F--Q--Y--K--P--V--G--K--L--C--P--K--N--F--E-
CTCCCTTTGTCCTTTAAGACAAATGAAAAGGGGAGTAATAGGAGATACCCCATACTTTCAATATAAACCTGTAGGAAAACTATGTCCTAAAAATTTTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--P--S--K--T--L--I--W--G--D--C--V--N--S--H--A--V--V--L--K--N--D--S--Y--A--L--V--I--D--W--A--P--K--
GGCCCATCTAAAACTTTAATTTGGGGAGATTGTGTTAACTCACATGCAGTAGTATTAAAAAATGACTCATATGCTTTAGTAATAGACTGGGCACCAAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--Y--L--K--N--T--C--S--S--G--G--G--E--F--L--E--A--T--Y--F--I--S--Y--W--E--D--E--D--H--H--P--T--L--H
GCTATTTAAAAAACACTTGCTCCTCTGGGGGAGGGGAATTCCTGGAGGCTACTTATTTTATTTCTTATTGGGAGGACGAGGATCATCATCCTACTTTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------->
--R--W--F--G--S--F--F--T--L--K--W--E--D--K--D--I--T--L--H--P--Q--G--L--V--*-
TAGGTGGTTCGGCTCATTCTTTACCTTAAAATGGGAAGATAAGGACATTACCCTCCACCCCCAAGGCCTTGTATGA
                                                                            
----------------------------------------------------------------------------
----------------------------------------------------------------------------