Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000148513 (click for geneview)
Transcript ID ENST00000361713(link to ensembl)
Symbol ANKRD30A
Localtion Chromosome:10:37454791:37561501:1 band: 10p11.21
Description ankyrin repeat domain 30A [Source:RefSeq_peptide;Acc:NP_443723]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------><----------------------------------------------
-M--T--K--R--K--K--T--I--N--L--N--I--Q--D--A--Q--K--R--T--A--L--H--W--A--C--V--N--G--H--E--E--V--V--
ATGACAAAGAGGAAGAAGACCATCAACCTTAATATACAAGACGCCCAGAAGAGGACTGCTCTACACTGGGCCTGTGTCAATGGCCATGAGGAAGTAGTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------><-------------------------------
T--F--L--V--D--R--K--C--Q--L--D--V--L--D--G--E--H--R--T--P--L--M--K--A--L--Q--C--H--Q--E--A--C--A--N
CATTTCTGGTAGACAGAAAGTGCCAGCTTGACGTCCTTGATGGCGAACACAGGACACCTCTGATGAAGGCTCTACAATGCCATCAGGAGGCTTGTGCAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--I--L--I--D--S--G--A--D--I--N--L--V--D--V--Y--G--N--T--A--L--H--Y--A--V--Y--S--E--I--L--S--V--V--A-
TATTCTGATAGATTCTGGTGCCGATATAAATCTCGTAGATGTGTATGGCAACACGGCTCTCCATTATGCTGTTTATAGTGAGATTTTGTCAGTGGTGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
-K--L--L--S--H--G--A--V--I--E--V--H--N--K--A--S--L--T--P--L--L--L--S--I--T--K--R--S--E--Q--I--V--E--
AAACTGCTGTCCCATGGTGCAGTCATCGAAGTGCACAACAAGGCTAGCCTCACACCACTTTTACTATCCATAACGAAAAGAAGTGAGCAAATTGTGGAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------><--------------------------------------------------
F--L--L--I--K--N--A--N--A--N--A--V--N--K--Y--K--C--T--A--L--M--L--A--V--C--H--G--S--S--E--I--V--G--M
TTTTGCTGATAAAAAATGCAAATGCGAATGCAGTTAATAAGTATAAATGCACAGCCCTCATGCTTGCTGTATGTCATGGATCATCAGAGATAGTTGGCAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------><------------
--L--L--Q--Q--N--V--D--V--F--A--A--D--I--C--G--V--T--A--E--H--Y--A--V--T--C--G--F--H--H--I--H--E--Q-
GCTTCTTCAGCAAAATGTTGACGTCTTTGCTGCAGATATATGTGGAGTAACTGCAGAACATTATGCTGTTACTTGTGGATTTCATCACATTCATGAACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
-I--M--E--Y--I--R--K--L--S--K--N--H--Q--N--T--N--P--E--G--T--S--A--G--T--P--D--E--A--A--P--L--A--E--
ATTATGGAATATATACGAAAATTATCTAAAAATCATCAAAATACCAATCCAGAAGGAACATCTGCAGGAACACCTGATGAGGCTGCACCCTTGGCGGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--T--P--D--T--A--E--S--L--V--E--K--T--P--D--E--A--A--P--L--V--E--R--T--P--D--T--A--E--S--L--V--E--K
GAACACCTGACACAGCTGAAAGCTTGGTGGAAAAAACACCTGATGAGGCTGCACCCTTGGTGGAAAGAACACCTGACACGGCTGAAAGCTTGGTGGAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--P--D--E--A--A--S--L--V--E--G--T--S--D--K--I--Q--C--L--E--K--A--T--S--G--K--F--E--Q--S--A--E--E-
AACACCTGATGAGGCTGCATCCTTGGTGGAGGGAACATCTGACAAAATTCAATGTTTGGAGAAAGCGACATCTGGAAAGTTCGAACAGTCAGCAGAAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--P--R--E--I--T--S--P--A--K--E--T--S--E--K--F--T--W--P--A--K--G--R--P--R--K--I--A--W--E--K--K--E--
ACACCTAGGGAAATTACGAGTCCTGCAAAAGAAACATCTGAGAAATTTACGTGGCCAGCAAAAGGAAGACCTAGGAAGATCGCATGGGAGAAAAAAGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--T--P--R--E--I--M--S--P--A--K--E--T--S--E--K--F--T--W--A--A--K--G--R--P--R--K--I--A--W--E--K--K--E
ACACACCTAGGGAAATTATGAGTCCCGCAAAAGAAACATCTGAGAAATTTACGTGGGCAGCAAAAGGAAGACCTAGGAAGATCGCATGGGAGAAAAAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--P--V--K--T--G--C--V--A--R--V--T--S--N--K--T--K--V--L--E--K--G--R--S--K--M--I--A--C--P--T--K--E-
AACACCTGTAAAGACTGGATGCGTGGCAAGAGTAACATCTAATAAAACTAAAGTTTTGGAAAAAGGAAGATCTAAGATGATTGCATGTCCTACAAAAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><------------------------------------------------------------><------------
-S--S--T--K--A--S--A--N--D--Q--R--F--P--S--E--S--K--Q--E--E--D--E--E--Y--S--C--D--S--R--S--L--F--E--
TCATCTACAAAAGCAAGTGCCAATGATCAGAGGTTCCCATCAGAATCCAAACAAGAGGAAGATGAAGAATATTCTTGTGATTCTCGGAGTCTCTTTGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------><------------------------
S--S--A--K--I--Q--V--C--I--P--E--S--I--Y--Q--K--V--M--E--I--N--R--E--V--E--E--P--P--K--K--P--S--A--F
GTTCTGCAAAGATTCAAGTGTGTATACCTGAGTCTATATATCAAAAAGTAATGGAGATAAATAGAGAAGTAGAAGAGCCTCCTAAGAAGCCATCTGCCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---><-----------------------------------------------------------------------><----------------------
--K--P--A--I--E--M--Q--N--S--V--P--N--K--A--F--E--L--K--N--E--Q--T--L--R--A--D--P--M--F--P--P--E--S-
CAAGCCTGCCATTGAAATGCAAAACTCTGTTCCAAATAAAGCCTTTGAATTGAAGAATGAACAAACATTGAGAGCAGATCCGATGTTCCCACCAGAATCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------><------------------------------------------------------------
-K--Q--K--D--Y--E--E--N--S--W--D--S--E--S--L--C--E--T--V--S--Q--K--D--V--C--L--P--K--A--T--H--Q--K--
AAACAAAAGGACTATGAAGAAAATTCTTGGGATTCTGAGAGTCTCTGTGAGACTGTTTCACAGAAGGATGTGTGTTTACCCAAGGCTACACATCAAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------><----------------------------------------
E--I--D--K--I--N--G--K--L--E--E--S--P--N--K--D--G--L--L--K--A--T--C--G--M--K--V--S--I--P--T--K--A--L
AAATAGATAAAATAAATGGAAAATTAGAAGAGTCTCCTAATAAAGATGGTCTTCTGAAGGCTACCTGCGGAATGAAAGTTTCTATTCCAACTAAAGCCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><---------------------------><--------------------------------------
--E--L--K--D--M--Q--T--F--K--A--E--P--P--G--K--P--S--A--F--E--P--A--T--E--M--Q--K--S--V--P--N--K--A-
AGAATTGAAGGACATGCAAACTTTCAAAGCAGAGCCTCCGGGGAAGCCATCTGCCTTCGAGCCTGCCACTGAAATGCAAAAGTCTGTCCCAAATAAAGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------><------------------------------------------------------------><---
-L--E--L--K--N--E--Q--T--L--R--A--D--E--I--L--P--S--E--S--K--Q--K--D--Y--E--E--N--S--W--D--T--E--S--
TTGGAATTGAAAAATGAACAAACATTGAGAGCAGATGAGATACTCCCATCAGAATCCAAACAAAAGGACTATGAAGAAAATTCTTGGGATACTGAGAGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------><------------
L--C--E--T--V--S--Q--K--D--V--C--L--P--K--A--A--H--Q--K--E--I--D--K--I--N--G--K--L--E--G--S--P--V--K
TCTGTGAGACTGTTTCACAGAAGGATGTGTGTTTACCCAAGGCTGCGCATCAAAAAGAAATAGATAAAATAAATGGAAAATTAGAAGGGTCTCCTGTTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><-----------------------------------------------------------------------><----------
--D--G--L--L--K--A--N--C--G--M--K--V--S--I--P--T--K--A--L--E--L--M--D--M--Q--T--F--K--A--E--P--P--E-
AGATGGTCTTCTGAAGGCTAACTGCGGAATGAAAGTTTCTATTCCAACTAAAGCCTTAGAATTGATGGACATGCAAACTTTCAAAGCAGAGCCTCCCGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><-----------------------------------------------------------------------><--------
-K--P--S--A--F--E--P--A--I--E--M--Q--K--S--V--P--N--K--A--L--E--L--K--N--E--Q--T--L--R--A--D--E--I--
AAGCCATCTGCCTTCGAGCCTGCCATTGAAATGCAAAAGTCTGTTCCAAATAAAGCCTTGGAATTGAAGAATGAACAAACATTGAGAGCAGATGAGATAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
L--P--S--E--S--K--Q--K--D--Y--E--E--S--S--W--D--S--E--S--L--C--E--T--V--S--Q--K--D--V--C--L--P--K--A
TCCCATCAGAATCCAAACAAAAGGACTATGAAGAAAGTTCTTGGGATTCTGAGAGTCTCTGTGAGACTGTTTCACAGAAGGATGTGTGTTTACCCAAGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><---------------------------><--------------------------
--T--H--Q--K--E--I--D--K--I--N--G--K--L--E--E--S--P--D--N--D--G--F--L--K--A--P--C--R--M--K--V--S--I-
TACGCATCAAAAAGAAATAGATAAAATAAATGGAAAATTAGAAGAGTCTCCTGATAATGATGGTTTTCTGAAGGCTCCCTGCAGAATGAAAGTTTCTATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------><---------------------------><------------------------
-P--T--K--A--L--E--L--M--D--M--Q--T--F--K--A--E--P--P--E--K--P--S--A--F--E--P--A--I--E--M--Q--K--S--
CCAACTAAAGCCTTAGAATTGATGGACATGCAAACTTTCAAAGCAGAGCCTCCCGAGAAGCCATCTGCCTTCGAGCCTGCCATTGAAATGCAAAAGTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
V--P--N--K--A--L--E--L--K--N--E--Q--T--L--R--A--D--Q--M--F--P--S--E--S--K--Q--K--K--V--E--E--N--S--W
TTCCAAATAAAGCCTTGGAATTGAAGAATGAACAAACATTGAGAGCAGATCAGATGTTCCCTTCAGAATCAAAACAAAAGAAGGTTGAAGAAAATTCTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------><-----------------------------------------------------------------------------------------
--D--S--E--S--L--R--E--T--V--S--Q--K--D--V--C--V--P--K--A--T--H--Q--K--E--M--D--K--I--S--G--K--L--E-
GGATTCTGAGAGTCTCCGTGAGACTGTTTCACAGAAGGATGTGTGTGTACCCAAGGCTACACATCAAAAAGAAATGGATAAAATAAGTGGAAAATTAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

><--------------------------------------------------------------------------------------------------
-D--S--T--S--L--S--K--I--L--D--T--V--H--S--C--E--R--A--R--E--L--Q--K--D--H--C--E--Q--R--T--G--K--M--
GATTCAACTAGCCTATCAAAAATCTTGGATACAGTTCATTCTTGTGAAAGAGCAAGGGAACTTCAAAAAGATCACTGTGAACAACGTACAGGAAAAATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--Q--M--K--K--K--F--C--V--L--K--K--K--L--S--E--A--K--E--I--K--S--Q--L--E--N--Q--K--V--K--W--E--Q--E
AACAAATGAAAAAGAAGTTTTGTGTACTGAAAAAGAAACTGTCAGAAGCAAAAGAAATAAAATCACAGTTAGAGAACCAAAAAGTTAAATGGGAACAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
--L--C--S--V--R--L--T--L--N--Q--E--E--E--K--R--R--N--A--D--I--L--N--E--K--I--R--E--E--L--G--R--I--E-
GCTCTGCAGTGTGAGATTGACTTTAAACCAAGAAGAAGAGAAGAGAAGAAATGCCGATATATTAAATGAAAAAATTAGGGAAGAATTAGGAAGAATCGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------><
-E--Q--H--R--K--E--L--E--V--K--Q--Q--L--E--Q--A--L--R--I--Q--D--I--E--L--K--S--V--E--S--N--L--N--Q--
GAGCAGCATAGGAAAGAGTTAGAAGTGAAACAACAACTTGAACAGGCTCTCAGAATACAAGATATAGAATTGAAGAGTGTAGAAAGTAATTTGAATCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--S--H--T--H--E--N--E--N--Y--L--L--H--E--N--C--M--L--K--K--E--I--A--M--L--K--L--E--I--A--T--L--K--H
TTTCTCACACTCATGAAAATGAAAATTATCTCTTACATGAAAATTGCATGTTGAAAAAGGAAATTGCCATGCTAAAACTGGAAATAGCCACACTGAAACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--Y--Q--E--K--E--N--K--Y--F--E--D--I--K--I--L--K--E--K--N--A--E--L--Q--M--T--L--K--L--K--E--E--S-
CCAATACCAGGAAAAGGAAAATAAATACTTTGAGGACATTAAGATTTTAAAAGAAAAGAATGCTGAACTTCAGATGACCCTAAAACTGAAAGAGGAATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--T--K--R--A--S--Q--Y--S--G--Q--L--K--V--L--I--A--E--N--T--M--L--T--S--K--L--K--E--K--Q--D--K--E--
TTAACTAAAAGGGCATCTCAATATAGTGGGCAGCTTAAAGTTCTGATAGCTGAGAACACAATGCTCACTTCTAAATTGAAGGAAAAACAAGACAAAGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--L--E--A--E--I--E--S--H--H--P--R--L--A--S--A--V--Q--D--H--D--Q--I--V--T--S--R--K--S--Q--E--P--A--F
TACTAGAGGCAGAAATTGAATCACACCATCCTAGACTGGCTTCTGCTGTACAAGACCATGATCAAATTGTGACATCAAGAAAAAGTCAAGAACCTGCTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--I--A--G--D--A--C--L--Q--R--K--M--N--V--D--V--S--S--T--I--Y--N--N--E--V--L--H--Q--P--L--S--E--A-
CCACATTGCAGGAGATGCTTGTTTGCAAAGAAAAATGAATGTTGATGTGAGTAGTACGATATATAACAATGAGGTGCTCCATCAACCACTTTCTGAAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--R--K--S--K--S--L--K--I--N--L--N--Y--A--G--D--A--L--R--E--N--T--L--V--S--E--H--A--Q--R--D--Q--R--
CAAAGGAAATCCAAAAGCCTAAAAATTAATCTCAATTATGCAGGAGATGCTCTAAGAGAAAATACATTGGTTTCAGAACATGCACAAAGAGACCAACGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--T--Q--C--Q--M--K--E--A--E--H--M--Y--Q--N--E--Q--D--N--V--N--K--H--T--E--Q--Q--E--S--L--D--Q--K--L
AAACACAGTGTCAAATGAAGGAAGCTGAACACATGTATCAAAACGAACAAGATAATGTGAACAAACACACTGAACAGCAGGAGTCTCTAGATCAGAAATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--Q--L--Q--S--K--N--M--W--L--Q--Q--Q--L--V--H--A--H--K--K--A--D--N--K--S--K--I--T--I--D--I--H--F-
ATTTCAACTACAAAGCAAAAATATGTGGCTTCAACAGCAATTAGTTCATGCACATAAGAAAGCTGACAACAAAAGCAAGATAACAATTGATATTCATTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--E--R--K--M--Q--H--H--L--L--K--E--K--N--E--E--I--F--N--Y--N--N--H--L--K--N--R--I--Y--Q--Y--E--K--
CTTGAGAGGAAAATGCAACATCATCTCCTAAAAGAGAAAAATGAGGAGATATTTAATTACAATAACCATTTAAAAAACCGTATATATCAATATGAAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------><------->
E--K--A--E--T--E--N--S--*-
AGAAAGCAGAAACAGAAAACTCATGA
                          
--------------------------
--------------------------