Sequences
EST Library Info
csp1Spleen - RNA from China
jej1Small intestine, jejunum
med1Mediastinum
pigca1Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000198851 (click for geneview)
Transcript ID ENST00000361763(link to ensembl)
Symbol CD3E
Localtion Chromosome:11:117680662:117692096:1 band: 11q23.3
Description T-cell surface glycoprotein CD3 epsilon chain precursor (T-cell surface antigen T3/Leu-4 epsilon chain). [Source:Uniprot/SWISSPROT;Acc:P07766]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------><-------------------><-------------><--------------
-M--Q--S--G--T--H--W--R--V--L--G--L--C--L--L--S--V--G--V--W--G--Q--D--G--N--E--E--M--G--G--I--T--Q--
ATGCAGTCGGGCACTCACTGGAGAGTTCTGGGCCTCTGCCTCTTATCAGTTGGCGTTTGGGGGCAAGATGGTAATGAAGAAATGGGTGGTATTACACAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------------------
T--P--Y--K--V--S--I--S--G--T--T--V--I--L--T--C--P--Q--Y--P--G--S--E--I--L--W--Q--H--N--D--K--N--I--G
CACCATATAAAGTCTCCATCTCTGGAACCACAGTAATATTGACATGCCCTCAGTATCCTGGATCTGAAATACTATGGCAACACAATGATAAAAACATAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--D--E--D--D--K--N--I--G--S--D--E--D--H--L--S--L--K--E--F--S--E--L--E--Q--S--G--Y--Y--V--C--Y--P-
CGGTGATGAGGATGATAAAAACATAGGCAGTGATGAGGATCACCTGTCACTGAAGGAATTTTCAGAATTGGAGCAAAGTGGTTATTATGTCTGCTACCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
-R--G--S--K--P--E--D--A--N--F--Y--L--Y--L--R--A--R--V--C--E--N--C--M--E--M--D--V--M--S--V--A--T--I--
AGAGGAAGCAAACCAGAAGATGCGAACTTTTATCTCTACCTGAGGGCAAGAGTGTGTGAGAACTGCATGGAGATGGATGTGATGTCGGTGGCCACAATTG
                                                      ::::::::::::.:::::.::::: ::::: :.::::.::::::..
------------------------------------------------------TGTGAGAACTGCGTGGAGGTGGATCTGATGGCAGTGGTCACAATCA
-------------------------------------------------------C--E--N--C--V--E--V--D--L--M--A--V--V--T--I--

----------------------------------------------------------------------------------------------------
V--I--V--D--I--C--I--T--G--G--L--L--L--L--V--Y--Y--W--S--K--N--R--K--A--K--A--K--P--V--T--R--G--A--G
TCATAGTGGACATCTGCATCACTGGGGGCTTGCTGCTGCTGGTTTACTACTGGAGCAAGAATAGAAAGGCCAAGGCCAAGCCTGTGACACGAGGAGCGGG
:..:::: :::::::::::::::  :::.:::::: :: :::: ::.::::. :::::::.::::::::::::::::: :::::::::. ::::::::::
TTGTAGTTGACATCTGCATCACTCTGGGTTTGCTGATGGTGGTGTATTACTACAGCAAGAGTAGAAAGGCCAAGGCCATGCCTGTGACGAGAGGAGCGGG
I--V--V--D--I--C--I--T--L--G--L--L--M--V--V--Y--Y--Y--S--K--S--R--K--A--K--A--M--P--V--T--R--G--A--G

-------------------><---------------------------------------------><--------------------------------
--A--G--G--R--Q--R--G--Q--N--K--E--R--P--P--P--V--P--N--P--D--Y--E--P--I--R--K--G--Q--R--D--L--Y--S-
TGCTGGCGGCAGGCAAAGGGGACAAAACAAGGAGAGGCCACCACCTGTTCCCAACCCAGACTATGAGCCCATCCGGAAAGGCCAGCGGGACCTGTATTCT
:::::: :::::::  :::   :::::::.::::::::::::::::::.:::::.:::::::::::::::::::::::::::::::::::::::::: ::
TGCTGGAGGCAGGCCCAGG---CAAAACAGGGAGAGGCCACCACCTGTCCCCAATCCAGACTATGAGCCCATCCGGAAAGGCCAGCGGGACCTGTATACT
--A--G--G--R--P--R-----Q--N--R--E--R--P--P--P--V--P--N--P--D--Y--E--P--I--R--K--G--Q--R--D--L--Y--T-

----------------------->
-G--L--N--Q--R--R--I--*-
GGCCTGAATCAGAGACGCATCTGA
:::::::::::::::         
GGCCTGAATCAGAGA---------
-G--L--N--Q--R----------

Pig Consensus Sequence

>BGISUST0000884006
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------TGTGAGAACTGCGTGGAGGTGGATCTGATGGCAGTGGTCACAATCA
TTGTAGTTGACATCTGCATCACTCTGGGTTTGCTGATGGTGGTGTATTACTACAGCAAGAGTAGAAAGGCCAAGGCCATGCCTGTGACGAGAGGAGCGGG
TGCTGGAGGCAGGCCCAGG---CAAAACAGGGAGAGGCCACCACCTGTCCCCAATCCAGACTATGAGCCCATCCGGAAAGGCCAGCGGGACCTGTATACT
GGCCTGAATCAGAGA---------


>BGISUSP0000884006
----------------------------------------------------------------------------------------------------
------------------CENCVEVDLMAVVTIIVVDICITLGLLMVVYYYSKSRKAKAMPVTRGAGAGGRPR-QNRERPPPVPNPDYEPIRKGQRDLYT
GLNQR---