Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000080823 (click for geneview)
Transcript ID ENST00000361847(link to ensembl)
Symbol RAGE
Localtion Chromosome:14:101764932:101841284:-1 band: 14q32.32
Description MAPK/MAK/MRK overlapping kinase (EC 2.7.1.37) (MOK protein kinase) (Renal tumor antigen 1) (RAGE-1). [Source:Uniprot/SWISSPROT;Acc:Q9UQ07]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----><--------------------------------------------------------------------------------------------
-M--K--N--Y--K--A--I--G--K--I--G--E--G--T--F--S--E--V--M--K--M--Q--S--L--R--D--G--N--Y--Y--A--C--K--
ATGAAGAACTATAAAGCAATTGGCAAAATAGGAGAGGGAACGTTTTCTGAAGTTATGAAGATGCAAAGCCTGAGAGATGGAAACTACTATGCATGTAAAC
         :::::::::::..:::::::::::::::::::::::::::::::::::::::::::.:.::::::::::::::::::::::::::::::::
---------TATAAAGCAATCAGCAAAATAGGAGAGGGAACGTTTTCTGAAGTTATGAAGATGCAGAACCTGAGAGATGGAAACTACTATGCATGTAAAC
----------Y--K--A--I--S--K--I--G--E--G--T--F--S--E--V--M--K--M--Q--N--L--R--D--G--N--Y--Y--A--C--K--

---------------------><-----------------------------------------------------------------------------
Q--M--K--Q--R--F--E--S--I--E--Q--V--N--N--L--R--E--I--Q--A--L--R--R--L--N--P--H--P--N--I--L--M--L--H
AAATGAAGCAGCGCTTTGAAAGTATTGAGCAAGTCAACAACCTACGAGAGATCCAAGCACTGAGGCGCCTGAATCCGCACCCAAACATTCTTATGTTGCA
:::::::.::::.:::::::   ::.:::::::: ::::..::.:::::::: ::::: :::::::::::::::::.:::::::::::.::.:.:.::::
AAATGAAACAGCACTTTGAA---ATCGAGCAAGTGAACAGTCTGCGAGAGATACAAGCCCTGAGGCGCCTGAATCCACACCCAAACATCCTCACGCTGCA
Q--M--K--Q--H--F--E-----I--E--Q--V--N--S--L--R--E--I--Q--A--L--R--R--L--N--P--H--P--N--I--L--T--L--H

-----------><---------------------------------------------------------------------><----------------
--E--V--V--F--D--R--K--S--G--S--L--A--L--I--C--E--L--M--D--M--N--I--Y--E--L--I--R--G--R--R--Y--P--L-
TGAAGTGGTTTTTGACAGAAAATCTGGTTCTCTTGCACTAATATGTGAACTTATGGACATGAATATTTATGAGCTAATACGAGGGAGAAGATACCCATTA
.:::::: ::   :::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::: :::    :::::.: ::.:::
CGAAGTGCTT---GACAGAAAATCTGGTTCTCTTGCGCTAATATGTGAACTTATGGACATGAATATTTATGAGCTAATTCGA---CGAAGACAGCCGTTA
--E--V--L-----D--R--K--S--G--S--L--A--L--I--C--E--L--M--D--M--N--I--Y--E--L--I--R-----R--R--Q--P--L-

-------------------------------------------------------------><-------------------------------------
-S--E--K--K--I--M--H--Y--M--Y--Q--L--C--K--S--L--D--H--I--H--R--N--G--I--F--H--R--D--V--K--P--E--N--
TCAGAAAAAAAAATTATGCACTATATGTACCAGTTATGTAAGTCCCTGGATCATATTCACAGAAATGGAATATTTCACAGAGATGTAAAACCAGAAAATA
::::::::.:::::: .::.:::::::::::::::.:::::.::::: :::::.:: :::   :::::::::::::::::::::::::::::::::::::
TCAGAAAAGAAAATTTCGCGCTATATGTACCAGTTGTGTAAATCCCTTGATCACATGCAC---AATGGAATATTTCACAGAGATGTAAAACCAGAAAATA
-S--E--K--K--I--S--R--Y--M--Y--Q--L--C--K--S--L--D--H--M--H-----N--G--I--F--H--R--D--V--K--P--E--N--

----------><----------------------------------------------------------------------------------------
I--L--I--K--Q--D--V--L--K--L--G--D--F--G--S--C--R--S--V--Y--S--K--Q--P--Y--T--E--Y--I--S--T--R--W--Y
TACTAATAAAGCAGGATGTCCTGAAATTAGGGGACTTTGGCTCCTGCCGGAGTGTCTATTCCAAGCAGCCGTACACGGAATACATCTCCACCCGCTGGTA
::.::::::::::::::::::::::.:::::::::::.:: :::::::::::.::::.:::.:::::::::.::::.::.:::.::::::::::::::::
TATTAATAAAGCAGGATGTCCTGAAGTTAGGGGACTTCGGGTCCTGCCGGAGCGTCTGTTCTAAGCAGCCGCACACAGAGTACGTCTCCACCCGCTGGTA
I--L--I--K--Q--D--V--L--K--L--G--D--F--G--S--C--R--S--V--C--S--K--Q--P--H--T--E--Y--V--S--T--R--W--Y

-----------------------------------------------------------------------------------------><---------
--R--A--P--E--C--L--L--T--D--G--F--Y--T--Y--K--M--D--L--W--S--A--G--C--V--F--Y--E--I--A--S--L--Q--P-
CCGGGCCCCGGAGTGTCTCCTCACTGATGGGTTCTACACGTACAAGATGGACCTGTGGAGCGCCGGCTGTGTGTTCTACGAGATCGCCAGTCTGCAGCCC
:::::::::::::::::: :::::.::.:: :::::: : :::::::::::::::                                    :::::::: 
CCGGGCCCCGGAGTGTCTGCTCACCGACGGCTTCTACTCCTACAAGATGGACCTG------------------------------------CTGCAGCCG
--R--A--P--E--C--L--L--T--D--G--F--Y--S--Y--K--M--D--L--------------------------------------L--Q--P-

-------------------------------------------------------------------------------------------><-------
-L--F--P--G--V--N--E--L--D--Q--I--S--K--I--H--D--V--I--G--T--P--A--Q--K--I--L--T--K--F--K--Q--S--R--
CTCTTTCCTGGAGTAAATGAACTGGACCAAATCTCAAAAATCCACGATGTCATCGGCACACCCGCTCAGAAGATCCTCACCAAGTTCAAACAGTCGAGAG
:::::.:::::::. ::.::.::::::::.:::::::::::::::::..:::: :::::.::.:::  .::::.::::: ::::::: ::   :::::::
CTCTTCCCTGGAGCCAACGAGCTGGACCAGATCTCAAAAATCCACGACATCATGGGCACGCCTGCTGCAAAGACCCTCAGCAAGTTCCAA---TCGAGAG
-L--F--P--G--A--N--E--L--D--Q--I--S--K--I--H--D--I--M--G--T--P--A--A--K--T--L--S--K--F--Q-----S--R--

----------------------------------------------------------------------------------------------------
A--M--N--F--D--F--P--F--K--K--G--S--G--I--P--L--L--T--T--N--L--S--P--Q--C--L--S--L--L--H--A--M--V--A
CTATGAATTTTGATTTTCCTTTTAAAAAGGGATCAGGAATACCTCTACTAACAACCAATTTGTCCCCACAATGCCTCTCCCTCCTGCACGCAATGGTGGC
::.:::.:::.::.:::::::::: ::::::.:::::::: ::: :.:.:::..:::.:.:::::::.::.:::::::: :::::::.::::::::::::
CTGTGAGTTTCGACTTTCCTTTTACAAAGGGGTCAGGAATCCCTGTGCCAACGGCCAGTCTGTCCCCGCAGTGCCTCTCGCTCCTGCGCGCAATGGTGGC
A--V--S--F--D--F--P--F--T--K--G--S--G--I--P--V--P--T--A--S--L--S--P--Q--C--L--S--L--L--R--A--M--V--A

-----------------------------------------------------------------><---------------------------------
--Y--D--P--D--E--R--I--A--A--H--Q--A--L--Q--H--P--Y--F--Q--E--Q--R--K--T--E--K--R--A--L--G--S--H--R-
CTATGATCCCGATGAGAGAATCGCCGCCCACCAGGCCCTGCAGCACCCCTACTTCCAAGAACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGA
::::::.:::::::: ::..::.:.::::::::::::::::::::.::::::::::.:::.:::                                    
CTATGACCCCGATGACAGGGTCACTGCCCACCAGGCCCTGCAGCATCCCTACTTCCGAGAGCAG------------------------------------
--Y--D--P--D--D--R--V--T--A--H--Q--A--L--Q--H--P--Y--F--R--E--Q-------------------------------------

--------------------------------------------------------------------------------><------------------
-K--A--G--F--P--E--H--P--V--A--P--E--P--L--S--N--S--C--Q--I--S--K--E--G--R--K--Q--K--Q--S--L--K--Q--
AAAGCTGGCTTTCCGGAGCACCCTGTGGCACCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAGTCCCTAAAGCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--E--D--R--P--K--R--R--G--P--A--Y--V--M--E--L--P--K--L--K--L--S--G--V--V--R--L--S--S--Y--S--S--P--T
AGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTAAAGCTTTCGGGAGTGGTCAGACTGTCGTCTTACTCCAGCCCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
--L--Q--S--V--L--G--S--G--T--N--G--R--V--P--V--L--R--P--L--K--C--I--P--A--S--K--K--T--D--P--Q--K--D-
GCTGCAGTCCGTGCTTGGATCTGGAACAAATGGAAGAGTGCCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAGAAGGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------->
-L--K--P--A--P--Q--Q--C--R--L--P--T--I--V--R--K--G--G--R--*-
CTTAAGCCTGCCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAA
                                                            
------------------------------------------------------------
------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000890034
---------TATAAAGCAATCAGCAAAATAGGAGAGGGAACGTTTTCTGAAGTTATGAAGATGCAGAACCTGAGAGATGGAAACTACTATGCATGTAAAC
AAATGAAACAGCACTTTGAA---ATCGAGCAAGTGAACAGTCTGCGAGAGATACAAGCCCTGAGGCGCCTGAATCCACACCCAAACATCCTCACGCTGCA
CGAAGTGCTT---GACAGAAAATCTGGTTCTCTTGCGCTAATATGTGAACTTATGGACATGAATATTTATGAGCTAATTCGA---CGAAGACAGCCGTTA
TCAGAAAAGAAAATTTCGCGCTATATGTACCAGTTGTGTAAATCCCTTGATCACATGCAC---AATGGAATATTTCACAGAGATGTAAAACCAGAAAATA
TATTAATAAAGCAGGATGTCCTGAAGTTAGGGGACTTCGGGTCCTGCCGGAGCGTCTGTTCTAAGCAGCCGCACACAGAGTACGTCTCCACCCGCTGGTA
CCGGGCCCCGGAGTGTCTGCTCACCGACGGCTTCTACTCCTACAAGATGGACCTG------------------------------------CTGCAGCCG
CTCTTCCCTGGAGCCAACGAGCTGGACCAGATCTCAAAAATCCACGACATCATGGGCACGCCTGCTGCAAAGACCCTCAGCAAGTTCCAA---TCGAGAG
CTGTGAGTTTCGACTTTCCTTTTACAAAGGGGTCAGGAATCCCTGTGCCAACGGCCAGTCTGTCCCCGCAGTGCCTCTCGCTCCTGCGCGCAATGGTGGC
CTATGACCCCGATGACAGGGTCACTGCCCACCAGGCCCTGCAGCATCCCTACTTCCGAGAGCAG------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------


>BGISUSP0000890034
---YKAISKIGEGTFSEVMKMQNLRDGNYYACKQMKQHFE-IEQVNSLREIQALRRLNPHPNILTLHEVL-DRKSGSLALICELMDMNIYELIR-RRQPL
SEKKISRYMYQLCKSLDHMH-NGIFHRDVKPENILIKQDVLKLGDFGSCRSVCSKQPHTEYVSTRWYRAPECLLTDGFYSYKMDL------------LQP
LFPGANELDQISKIHDIMGTPAAKTLSKFQ-SRAVSFDFPFTKGSGIPVPTASLSPQCLSLLRAMVAYDPDDRVTAHQALQHPYFREQ------------
----------------------------------------------------------------------------------------------------
--------------------